GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 07:01:36, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_008431052            1259 bp    mRNA    linear   VRT 05-JUN-2025
DEFINITION  PREDICTED: Poecilia reticulata C-type lectin domain family 4 member
            G-like (LOC103477754), mRNA.
ACCESSION   XM_008431052
VERSION     XM_008431052.2
DBLINK      BioProject: PRJNA232869
KEYWORDS    RefSeq.
SOURCE      Poecilia reticulata (guppy)
  ORGANISM  Poecilia reticulata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
            Poeciliidae; Poeciliinae; Poecilia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_024346.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 21, 2016 this sequence version replaced XM_008431052.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000633615.1-RS_2025_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/30/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1259
                     /organism="Poecilia reticulata"
                     /mol_type="mRNA"
                     /strain="Guanapo"
                     /isolation_source="inbred female from a population that
                     was originally collected from the Guanapo drainage in
                     Trinidad in 2010"
                     /db_xref="taxon:8081"
                     /sex="female"
                     /linkage_group="LG16"
     gene            1..1259
                     /gene="LOC103477754"
                     /note="C-type lectin domain family 4 member G-like;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 2 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     4 samples with support for all annotated introns"
                     /db_xref="GeneID:103477754"
     CDS             25..1167
                     /gene="LOC103477754"
                     /codon_start=1
                     /product="C-type lectin domain family 4 member G-like"
                     /protein_id="XP_008429274.1"
                     /db_xref="GeneID:103477754"
                     /translation="
MKTANQQESIKTLITDRRQLIEEQKMMENEMEEVVRDRHLSLEKAGFIQKRLTQVREELNKERDELRNKIDELSREKDELSRKNDELSNEKDEPNDEKDELNKERDELSRKTEELSKERDELRNKINELSREKDELSRKNDELNNEKDELSRKTEELSKERDRLSEDKHELRQEKDKLNKEKKDLSTEKEELKKEREKLRVLTDQAEKRCRERDALKNFYDALMKFDNFPVRDLCPVSLRPKCQHCAKHEKSYKGHCYYIYPYDIGYANWDRSRQLCKTEGGDLVVIDDLEEQEFINNHTQKYDSDNHGYWIGLHHFRHNWSWVDGRRNFLEFWIEGIPRSSGAALHMPRQKATESWRAEDKMEASKFICERLEISWPFG"
     misc_feature    <40..>693
                     /gene="LOC103477754"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     misc_feature    760..1137
                     /gene="LOC103477754"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(1057..1059,1063..1065,1072..1074,1090..1092,
                     1096..1107,1114..1122)
                     /gene="LOC103477754"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
ORIGIN      
ctaatttgtgtttttatagtgaatatgaagacagccaatcagcaggaaagtatcaaaacccttataacagatagaagacaacttattgaggaacaaaagatgatggagaacgagatggaggaggtggtccgagacagacacctgagcctagaaaaagctgggtttatccaaaagaggctaactcaagtcagagaggagctgaacaaagagagagacgagctgaggaataagattgacgagctgagcagagagaaagatgagctgagcagaaagaacgacgagctgagcaatgagaaagacgagccgaacgatgagaaagacgagctgaacaaagagagagacgagctgagcaggaagacagaggagctgagcaaagagagagacgagctgaggaataagattaacgagctgagcagagagaaagatgagctgagcagaaagaatgacgagctgaacaatgagaaagatgagctgagcaggaagacagaggagctgagcaaagagagagacaggctgagtgaagacaaacacgagctgagacaggagaaagacaaactgaacaaagagaaaaaggatctgagcacagagaaagaggagctgaagaaagagagagagaagctgagagtattgacagaccaggcagagaagcgatgcagagagagagatgctctgaaaaacttttatgatgccctcatgaaatttgacaattttccagttcgtgatttgtgcccagtatcgttgagaccgaaatgccagcattgcgccaaacatgagaaatcctacaagggacactgctactatatttatccatatgacataggttatgcaaactgggaccgaagtcgacagttgtgtaagactgaaggtggagacttggttgtaattgatgatctggaggagcaggaatttatcaacaatcacacccagaaatacgattctgataaccatggatactggatagggttacatcactttcgacacaattggtcctgggttgatggacgtaggaactttcttgagttctggattgaggggattccccgttcgtcaggagcagcgctgcatatgccacgacaaaaagccacagagagctggagagcagaagacaagatggaagcatccaaattcatctgtgagcgtctggagatttcttggccctttggctaacactgttctcttaaagcttcaatcaagaatactcagcgtgtcatcacattttggtgaatgtcataaataaaagctcaatctctgaaagccaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]