GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-08 19:43:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_008031651             876 bp    mRNA    linear   PLN 07-FEB-2020
DEFINITION  Exserohilum turcica Et28A uncharacterized protein
            (SETTUDRAFT_165232), mRNA.
ACCESSION   XM_008031651
VERSION     XM_008031651.1
DBLINK      BioProject: PRJNA245152
            BioSample: SAMN00120049
KEYWORDS    RefSeq.
SOURCE      Exserohilum turcica Et28A
  ORGANISM  Exserohilum turcica Et28A
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Exserohilum.
REFERENCE   1  (bases 1 to 876)
  AUTHORS   Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R.,
            Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C.,
            Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J.,
            Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
            Lindquist,E., Barry,K., Schmutz,J., Baker,S.E., Ciuffetti,L.M.,
            Grigoriev,I.V., Zhong,S. and Turgeon,B.G.
  TITLE     Comparative genome structure, secondary metabolite, and effector
            coding capacity across Cochliobolus pathogens
  JOURNAL   PLoS Genet. 9 (1), E1003233 (2013)
   PUBMED   23357949
REFERENCE   2  (bases 1 to 876)
  AUTHORS   Ohm,R.A., Feau,N., Henrissat,B., Schoch,C.L., Horwitz,B.A.,
            Barry,K.W., Condon,B.J., Copeland,A.C., Dhillon,B., Glaser,F.,
            Hesse,C.N., Kosti,I., LaButti,K., Lindquist,E.A., Lucas,S.,
            Salamov,A.A., Bradshaw,R.E., Ciuffetti,L., Hamelin,R.C., Kema,G.H.,
            Lawrence,C., Scott,J.A., Spatafora,J.W., Turgeon,B.G., de Wit,P.J.,
            Zhong,S., Goodwin,S.B. and Grigoriev,I.V.
  TITLE     Diverse lifestyles and strategies of plant pathogenesis encoded in
            the genomes of eighteen Dothideomycetes fungi
  JOURNAL   PLoS Pathog. 8 (12), E1003037 (2012)
   PUBMED   23236275
REFERENCE   3  (bases 1 to 876)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (07-FEB-2020) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   4  (bases 1 to 876)
  AUTHORS   Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J.,
            Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
            Lindquist,E., Lucas,S., Barry,K., Schmutz,J., Condon,B.J., Leng,Y.,
            Wu,D., Bushley,K.E., MohdZainudin,N., Xue,C., Wang,R., Dhillon,B.,
            Tu,Z.J., Steffenson,B.J., Baker,S., Zhong,S., Turgeon,B.G. and
            Grigoriev,I.V.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (05-APR-2013) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_007360277).
            
            ##Metadata-START##
            Organism Display Name :: Setosphaeria turcica Et28A
            GOLD Stamp ID         :: Gi08417
            ##Metadata-END##
FEATURES             Location/Qualifiers
     source          1..876
                     /organism="Exserohilum turcica Et28A"
                     /mol_type="mRNA"
                     /strain="Et28A"
                     /db_xref="taxon:671987"
                     /chromosome="Unknown"
     gene            1..876
                     /locus_tag="SETTUDRAFT_165232"
                     /db_xref="GeneID:19399397"
     CDS             93..827
                     /locus_tag="SETTUDRAFT_165232"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_008029842.1"
                     /db_xref="GeneID:19399397"
                     /db_xref="InterPro:IPR001424"
                     /db_xref="InterPro:IPR006121"
                     /db_xref="JGIDB:Settu1_165232"
                     /translation="
MTVPPFETIFAVPMTCQSCIDDIEGSLYKLGGINKVTADLKEQLVSIEGTAAPSAIVEAIQATGRDAVLRGSGKSDSAAVCILESHAPQVENKVRGLVRMVEVGPSMTIIDLSIRGLSPGTYHATVRETGDISEGPESTGGIWELAQSQNEGKACRGVFGTVQVGKGGVGSVFLDKAIHIWETIGRSIVVAREQDGKFDKNDADTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
     misc_feature    93..791
                     /locus_tag="SETTUDRAFT_165232"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      
aggcaaagtggcatgctccttactctgtactttgacgtctcctgatccacacacaagcaattcaagcttcttagcatcttacttttcccacaatgacagtacctcctttcgagacgatattcgcagtgcctatgacatgccagtcatgcatcgacgacattgaaggctctctctacaagttgggtggcatcaacaaagtcacggccgacctcaaggaacaacttgtgtcgattgagggcacagcagcaccgtcggcgattgtagaggcgatccaagcgaccgggcgtgatgcggttctgcgaggatcgggcaaatcagacagcgcggcagtatgcattctagaatcacacgcaccacaggtagagaacaaggttcgcgggctggtgcgcatggttgaagttgggcccagtatgacgatcatcgacctgagtatcaggggactgtcacctggaacctaccatgccacagtaagagagacgggagacatctccgagggaccggaatcgactggcgggatttgggaacttgcacagtcacaaaacgaaggcaaggcgtgtcgaggtgtctttggaaccgttcaggttggaaaaggcggagtgggatcggtgtttctcgacaaagccattcacatctgggaaacgattgggcgtagcattgtggtcgcaagagaacaggacggcaagtttgacaagaacgacgcagatacactggttggggtcattgcacgcagcgcaggcgtctgggataacgacaagacggtgtgctcgtgctcgggcaagacggtgtggcaggagcgcgaggagcagcgcgaccgcggcatgctgtgaggctggccgccacgcagatagagcaagcaatcatagagccgggttagag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]