2025-07-08 19:43:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_008031651 876 bp mRNA linear PLN 07-FEB-2020 DEFINITION Exserohilum turcica Et28A uncharacterized protein (SETTUDRAFT_165232), mRNA. ACCESSION XM_008031651 VERSION XM_008031651.1 DBLINK BioProject: PRJNA245152 BioSample: SAMN00120049 KEYWORDS RefSeq. SOURCE Exserohilum turcica Et28A ORGANISM Exserohilum turcica Et28A Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Exserohilum. REFERENCE 1 (bases 1 to 876) AUTHORS Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C., Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J., Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Barry,K., Schmutz,J., Baker,S.E., Ciuffetti,L.M., Grigoriev,I.V., Zhong,S. and Turgeon,B.G. TITLE Comparative genome structure, secondary metabolite, and effector coding capacity across Cochliobolus pathogens JOURNAL PLoS Genet. 9 (1), E1003233 (2013) PUBMED 23357949 REFERENCE 2 (bases 1 to 876) AUTHORS Ohm,R.A., Feau,N., Henrissat,B., Schoch,C.L., Horwitz,B.A., Barry,K.W., Condon,B.J., Copeland,A.C., Dhillon,B., Glaser,F., Hesse,C.N., Kosti,I., LaButti,K., Lindquist,E.A., Lucas,S., Salamov,A.A., Bradshaw,R.E., Ciuffetti,L., Hamelin,R.C., Kema,G.H., Lawrence,C., Scott,J.A., Spatafora,J.W., Turgeon,B.G., de Wit,P.J., Zhong,S., Goodwin,S.B. and Grigoriev,I.V. TITLE Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi JOURNAL PLoS Pathog. 8 (12), E1003037 (2012) PUBMED 23236275 REFERENCE 3 (bases 1 to 876) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (07-FEB-2020) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 4 (bases 1 to 876) AUTHORS Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J., Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Lucas,S., Barry,K., Schmutz,J., Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., MohdZainudin,N., Xue,C., Wang,R., Dhillon,B., Tu,Z.J., Steffenson,B.J., Baker,S., Zhong,S., Turgeon,B.G. and Grigoriev,I.V. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (05-APR-2013) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_007360277). ##Metadata-START## Organism Display Name :: Setosphaeria turcica Et28A GOLD Stamp ID :: Gi08417 ##Metadata-END## FEATURES Location/Qualifiers source 1..876 /organism="Exserohilum turcica Et28A" /mol_type="mRNA" /strain="Et28A" /db_xref="taxon:671987" /chromosome="Unknown" gene 1..876 /locus_tag="SETTUDRAFT_165232" /db_xref="GeneID:19399397" CDS 93..827 /locus_tag="SETTUDRAFT_165232" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_008029842.1" /db_xref="GeneID:19399397" /db_xref="InterPro:IPR001424" /db_xref="InterPro:IPR006121" /db_xref="JGIDB:Settu1_165232" /translation="
MTVPPFETIFAVPMTCQSCIDDIEGSLYKLGGINKVTADLKEQLVSIEGTAAPSAIVEAIQATGRDAVLRGSGKSDSAAVCILESHAPQVENKVRGLVRMVEVGPSMTIIDLSIRGLSPGTYHATVRETGDISEGPESTGGIWELAQSQNEGKACRGVFGTVQVGKGGVGSVFLDKAIHIWETIGRSIVVAREQDGKFDKNDADTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
misc_feature 93..791 /locus_tag="SETTUDRAFT_165232" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
aggcaaagtggcatgctccttactctgtactttgacgtctcctgatccacacacaagcaattcaagcttcttagcatcttacttttcccacaatgacagtacctcctttcgagacgatattcgcagtgcctatgacatgccagtcatgcatcgacgacattgaaggctctctctacaagttgggtggcatcaacaaagtcacggccgacctcaaggaacaacttgtgtcgattgagggcacagcagcaccgtcggcgattgtagaggcgatccaagcgaccgggcgtgatgcggttctgcgaggatcgggcaaatcagacagcgcggcagtatgcattctagaatcacacgcaccacaggtagagaacaaggttcgcgggctggtgcgcatggttgaagttgggcccagtatgacgatcatcgacctgagtatcaggggactgtcacctggaacctaccatgccacagtaagagagacgggagacatctccgagggaccggaatcgactggcgggatttgggaacttgcacagtcacaaaacgaaggcaaggcgtgtcgaggtgtctttggaaccgttcaggttggaaaaggcggagtgggatcggtgtttctcgacaaagccattcacatctgggaaacgattgggcgtagcattgtggtcgcaagagaacaggacggcaagtttgacaagaacgacgcagatacactggttggggtcattgcacgcagcgcaggcgtctgggataacgacaagacggtgtgctcgtgctcgggcaagacggtgtggcaggagcgcgaggagcagcgcgaccgcggcatgctgtgaggctggccgccacgcagatagagcaagcaatcatagagccgggttagag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]