2024-05-19 13:12:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_007705049 735 bp mRNA linear PLN 06-FEB-2020 DEFINITION Bipolaris sorokiniana ND90Pr uncharacterized protein (COCSADRAFT_174196), partial mRNA. ACCESSION XM_007705049 VERSION XM_007705049.1 DBLINK BioProject: PRJNA245122 BioSample: SAMN02981285 KEYWORDS RefSeq. SOURCE Bipolaris sorokiniana ND90Pr ORGANISM Bipolaris sorokiniana ND90Pr Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Bipolaris. REFERENCE 1 (bases 1 to 735) AUTHORS Ohm,R.A., Feau,N., Henrissat,B., Schoch,C.L., Horwitz,B.A., Barry,K.W., Condon,B.J., Copeland,A.C., Dhillon,B., Glaser,F., Hesse,C.N., Kosti,I., LaButti,K., Lindquist,E.A., Lucas,S., Salamov,A.A., Bradshaw,R.E., Ciuffetti,L., Hamelin,R.C., Kema,G.H., Lawrence,C., Scott,J.A., Spatafora,J.W., Turgeon,B.G., de Wit,P.J., Zhong,S., Goodwin,S.B. and Grigoriev,I.V. TITLE Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi JOURNAL PLoS Pathog. 8 (12), E1003037 (2012) PUBMED 23236275 REFERENCE 2 (bases 1 to 735) AUTHORS Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C., Wang,R., Dhillon,B., Tu,Z.J., Steffenson,B.J., Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Lucas,S., Barry,K., Schmutz,J., Baker,S., Grigoriev,I.V., Zhong,S. and Turgeon,B.G. CONSRTM US DOE Joint Genome Institute (JGI-PGF) TITLE Comparative genome structure, secondary metabolite and effector coding capacity across Cochliobolus pathogens JOURNAL Unpublished REFERENCE 3 (bases 1 to 735) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (06-FEB-2020) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 4 (bases 1 to 735) AUTHORS Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J., Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Lucas,S., Barry,K., Schmutz,J., Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., MohdZainudin,N., Xue,C., Wang,R., Dhillon,B., Tu,Z.J., Steffenson,B.J., Baker,S., Zhong,S., Turgeon,B.G. and Grigoriev,I.V. CONSRTM US DOE Joint Genome Institute (JGI-PGF) TITLE Direct Submission JOURNAL Submitted (17-MAY-2012) US DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_006911907). ##Metadata-START## Organism Display Name :: Cochliobolus sativus ND90Pr GOLD Stamp ID :: Gi04490 ##Metadata-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..735 /organism="Bipolaris sorokiniana ND90Pr" /mol_type="mRNA" /strain="ND90Pr" /db_xref="taxon:665912" /chromosome="Unknown" gene <1..>735 /locus_tag="COCSADRAFT_174196" /db_xref="GeneID:19132900" CDS 1..735 /locus_tag="COCSADRAFT_174196" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_007703239.1" /db_xref="GeneID:19132900" /db_xref="InterPro:IPR001424" /db_xref="InterPro:IPR006121" /db_xref="JGIDB:Cocsa1_174196" /translation="
MTVTPFETIFAVPMTCQSCINDIEGSLHQLSGINKVTANLKEQLVSVEGTAAPSAIVEAIQATGRDAVLRGSGKSDSAAVCILESHAPQVENKVRGLVRMVEVSPGMTIVDLSIRGLSPGTYHATVRESGNISEGPESTGGIWELGQSQKETKPCRGIFGTVQVGEGGVGSVFLDKPIHIWEVIGRSIVVAREQDGKFDKNDADTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
misc_feature 22..699 /locus_tag="COCSADRAFT_174196" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
atgacggtaacgccctttgaaacgatattcgcagtgcccatgacctgtcagtcgtgcatcaacgacatcgagggttccctacatcagttgagtggtatcaacaaagtgactgccaacctcaaggagcaattagtatctgtcgagggcacagcagcaccgtcggccattgtagaggcgattcaagctactggccgtgatgctgttcttcgggggtctggcaaatcagacagtgcagcggtatgcattctagaatcacacgcgccacaggtggagaacaaggttcgcggcctggtgcgcatggtggaagtttctcctggtatgaccattgtggacttgagtataagagggttgtcacctggaacctatcatgctacagtacgtgagtcgggaaacatttccgagggacctgaatcgactggtgggatttgggaactcgggcagtcacaaaaagagaccaagccttgtcgaggcatctttggaactgttcaggttggagagggtggagtaggatcggtgtttctcgacaagcctatccacatctgggaagtgatcggacgcagcatcgtggttgcgagagagcaggacggcaagtttgacaagaacgatgcggacacgctagttggagtcattgcacgcagtgcgggcgtatgggataacgacaagacggtatgttcgtgttctggcaagacggtatggcaagagcgcgaggagcagcgtgatcgcggtatgctctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]