ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-25 08:06:08, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_007684986 735 bp mRNA linear PLN 05-JAN-2024
DEFINITION Bipolaris oryzae ATCC 44560 uncharacterized protein
(COCMIDRAFT_32444), partial mRNA.
ACCESSION XM_007684986
VERSION XM_007684986.1
DBLINK BioProject: PRJNA245121
BioSample: SAMN02981450
KEYWORDS RefSeq.
SOURCE Bipolaris oryzae ATCC 44560
ORGANISM Bipolaris oryzae ATCC 44560
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
Pleosporaceae; Bipolaris.
REFERENCE 1 (bases 1 to 735)
AUTHORS Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R.,
Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C.,
Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J.,
Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
Lindquist,E., Barry,K., Schmutz,J., Baker,S.E., Ciuffetti,L.M.,
Grigoriev,I.V., Zhong,S. and Turgeon,B.G.
TITLE Comparative genome structure, secondary metabolite, and effector
coding capacity across Cochliobolus pathogens
JOURNAL PLoS Genet. 9 (1), E1003233 (2013)
PUBMED 23357949
REFERENCE 2 (bases 1 to 735)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (29-DEC-2023) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (bases 1 to 735)
AUTHORS Ohm,R.A., Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Otillar,R.,
Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C.,
Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J.,
Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
Lindquist,E., Barry,K., Schmutz,J., Baker,S., Ciuffetti,L.M.,
Grigoriev,I.V., Zhong,S., Nordberg,B.G., Cantor,M.N. and Hua,S.X.
CONSRTM DOE Joint Genome Institute
TITLE Direct Submission
JOURNAL Submitted (18-SEP-2013) DOE Joint Genome Institute, 2800 Mitchell
Drive, Walnut Creek, CA 94598-1698, USA
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. This record is derived from an annotated genomic
sequence (NW_006911282).
##Metadata-START##
Organism Display Name :: Cochliobolus miyabeanus WK-1C, ATCC 44560
GOLD Stamp ID :: Gr00268
##Metadata-END##
COMPLETENESS: incomplete on both ends.
FEATURES Location/Qualifiers
source 1..735
/organism="Bipolaris oryzae ATCC 44560"
/mol_type="mRNA"
/strain="ATCC 44560"
/culture_collection="ATCC:44560"
/db_xref="taxon:930090"
/chromosome="Unknown"
gene <1..>735
/locus_tag="COCMIDRAFT_32444"
/db_xref="GeneID:19122106"
CDS 1..735
/locus_tag="COCMIDRAFT_32444"
/codon_start=1
/product="uncharacterized protein"
/protein_id="XP_007683176.1"
/db_xref="GeneID:19122106"
/db_xref="InterPro:IPR001424"
/db_xref="InterPro:IPR006121"
/db_xref="JGIDB:Cocmi1_32444"
/translation="
MAVTPFETIFAVPMTCQSCINDIEGSLHQLSGINKVTANLEEQLVSIEGTAAPSAIVEAIQATGRDAVLRGSGKSDSAAVCILESHAPQVENKVRGLVRMVEVSPGMTIVDLSIRGLSPGTYHATVRESGNISEGPESTGGIWELGQSQKATKPCRGIFGTVQVGKGGVGWVFLDKPIHIWEVIGRSIVVAREQDGKFDKNDADTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
misc_feature 22..699
/locus_tag="COCMIDRAFT_32444"
/note="copper, zinc superoxide dismutase; Region:
PLN02957"
/db_xref="CDD:215516"
ORIGIN
atggcggtaacaccctttgaaacgatattcgcagtgcccatgacctgtcagtcgtgcatcaacgacatcgagggttccctacaccagttgagtggtatcaacaaagtgactgccaacctcgaggagcaattagtgtctatcgagggcacagcagcgccgtcggccattgtagaggcgattcaagctactgggcgtgatgctgtccttcgggggtcaggcaaatcagacagtgcagcggtatgcattctagaatcacatgcgccacaggtggagaacaaggttcgcggcctggtgcgcatggtggaagtttctcctggtatgaccattgtggacttgagtataagagggttgtcacctggaacctatcatgctacagtacgtgagtcgggaaacatttccgagggacctgaatcgactggtggaatttgggaacttggtcagtcacaaaaggcgaccaagccttgtcgaggcatctttggaaccgttcaggttggaaagggtggagtaggatgggtgtttctcgacaagcctatccacatctgggaagtgattggacgcagcattgtggttgcgagagagcaggatggcaagtttgacaagaacgatgcggacacccttgttggggtcattgcacgcagtgcgggtgtatgggataacgacaagacagtgtgttcatgttcgggcaagacggtatggcaggagcgcgaggagcagcgcgatcgcggtatgctctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]