GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 10:24:21, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_007684986             735 bp    mRNA    linear   PLN 05-JAN-2024
DEFINITION  Bipolaris oryzae ATCC 44560 uncharacterized protein
            (COCMIDRAFT_32444), partial mRNA.
ACCESSION   XM_007684986
VERSION     XM_007684986.1
DBLINK      BioProject: PRJNA245121
            BioSample: SAMN02981450
KEYWORDS    RefSeq.
SOURCE      Bipolaris oryzae ATCC 44560
  ORGANISM  Bipolaris oryzae ATCC 44560
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Bipolaris.
REFERENCE   1  (bases 1 to 735)
  AUTHORS   Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R.,
            Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C.,
            Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J.,
            Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
            Lindquist,E., Barry,K., Schmutz,J., Baker,S.E., Ciuffetti,L.M.,
            Grigoriev,I.V., Zhong,S. and Turgeon,B.G.
  TITLE     Comparative genome structure, secondary metabolite, and effector
            coding capacity across Cochliobolus pathogens
  JOURNAL   PLoS Genet. 9 (1), E1003233 (2013)
   PUBMED   23357949
REFERENCE   2  (bases 1 to 735)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (29-DEC-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 735)
  AUTHORS   Ohm,R.A., Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Otillar,R.,
            Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C.,
            Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J.,
            Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A.,
            Lindquist,E., Barry,K., Schmutz,J., Baker,S., Ciuffetti,L.M.,
            Grigoriev,I.V., Zhong,S., Nordberg,B.G., Cantor,M.N. and Hua,S.X.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (18-SEP-2013) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_006911282).
            
            ##Metadata-START##
            Organism Display Name :: Cochliobolus miyabeanus WK-1C, ATCC 44560
            GOLD Stamp ID         :: Gr00268
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..735
                     /organism="Bipolaris oryzae ATCC 44560"
                     /mol_type="mRNA"
                     /strain="ATCC 44560"
                     /culture_collection="ATCC:44560"
                     /db_xref="taxon:930090"
                     /chromosome="Unknown"
     gene            <1..>735
                     /locus_tag="COCMIDRAFT_32444"
                     /db_xref="GeneID:19122106"
     CDS             1..735
                     /locus_tag="COCMIDRAFT_32444"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_007683176.1"
                     /db_xref="GeneID:19122106"
                     /db_xref="InterPro:IPR001424"
                     /db_xref="InterPro:IPR006121"
                     /db_xref="JGIDB:Cocmi1_32444"
                     /translation="
MAVTPFETIFAVPMTCQSCINDIEGSLHQLSGINKVTANLEEQLVSIEGTAAPSAIVEAIQATGRDAVLRGSGKSDSAAVCILESHAPQVENKVRGLVRMVEVSPGMTIVDLSIRGLSPGTYHATVRESGNISEGPESTGGIWELGQSQKATKPCRGIFGTVQVGKGGVGWVFLDKPIHIWEVIGRSIVVAREQDGKFDKNDADTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
     misc_feature    22..699
                     /locus_tag="COCMIDRAFT_32444"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      
atggcggtaacaccctttgaaacgatattcgcagtgcccatgacctgtcagtcgtgcatcaacgacatcgagggttccctacaccagttgagtggtatcaacaaagtgactgccaacctcgaggagcaattagtgtctatcgagggcacagcagcgccgtcggccattgtagaggcgattcaagctactgggcgtgatgctgtccttcgggggtcaggcaaatcagacagtgcagcggtatgcattctagaatcacatgcgccacaggtggagaacaaggttcgcggcctggtgcgcatggtggaagtttctcctggtatgaccattgtggacttgagtataagagggttgtcacctggaacctatcatgctacagtacgtgagtcgggaaacatttccgagggacctgaatcgactggtggaatttgggaacttggtcagtcacaaaaggcgaccaagccttgtcgaggcatctttggaaccgttcaggttggaaagggtggagtaggatgggtgtttctcgacaagcctatccacatctgggaagtgattggacgcagcattgtggttgcgagagagcaggatggcaagtttgacaagaacgatgcggacacccttgttggggtcattgcacgcagtgcgggtgtatgggataacgacaagacagtgtgttcatgttcgggcaagacggtatggcaggagcgcgaggagcagcgcgatcgcggtatgctctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]