GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:25:05, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_007665160             584 bp    mRNA    linear   MAM 15-APR-2016
DEFINITION  PREDICTED: Ornithorhynchus anatinus NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), partial mRNA.
ACCESSION   XM_007665160
VERSION     XM_007665160.1
DBLINK      BioProject: PRJNA19039
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Ornithorhynchus anatinus (platypus)
  ORGANISM  Ornithorhynchus anatinus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Monotremata; Ornithorhynchidae; Ornithorhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001779368.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Ornithorhynchus anatinus Annotation
                                           Release 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 5% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..584
                     /organism="Ornithorhynchus anatinus"
                     /mol_type="mRNA"
                     /isolate="Glennie"
                     /db_xref="taxon:9258"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver; lung; brain; spleen"
                     /country="Australia: Upper Barnard River on Glen Rock
                     Station, New South Wales"
     gene            <1..584
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 94% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:103169581"
     CDS             <1..584
                     /gene="NRDE2"
                     /codon_start=3
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_007663350.1"
                     /db_xref="GeneID:103169581"
                     /translation="
EDEDDDPEEDDEEIKDKTLPKWQIWLNVERSRERRHWLPWRPDKTKKQTDEDCEDPERQVLFDDLEESLIQLSSPELKFQLLISFLQFLGVPSKYELSTSCLYLAMDESSIFENGLSDDKPLTFLDLLFSGVSCIGHMDMMNRRQQLTGHCREGEEFIQNVFCVILPLFSGTERSHLCFSWLQYEISKAYVMT"
ORIGIN      
atgaggatgaagatgatgatccagaagaagatgatgaagaaataaaggataaaactctacccaaatggcagatctggttaaatgtcgaacgttctcgtgaacgaagacactggctaccttggcgcccagacaaaaccaaaaagcagactgatgaggactgtgaagacccagagaggcaggtattatttgatgatcttgaggagtctttgatccaactctctagcccagagctcaaatttcaactgcttatttcatttctgcaattcttgggagtcccttccaaatatgagctctctacttcgtgcctctatcttgcaatggatgaaagcagcatttttgaaaatggactttctgatgacaagccactgactttccttgacctactgttttctggagttagttgcataggccacatggatatgatgaacagaaggcaacaactcacaggccactgtagagaaggagaggagttcattcagaatgtcttctgtgtaatattgcctctgttctcaggaactgaaagatctcatctctgcttctcttggttacaatatgaaatatctaaggcttatgtgatgacatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]