GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 08:31:41, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_007102680            3974 bp    mRNA    linear   MAM 23-FEB-2018
DEFINITION  PREDICTED: Physeter catodon NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), mRNA.
ACCESSION   XM_007102680
VERSION     XM_007102680.2
DBLINK      BioProject: PRJNA434122
KEYWORDS    RefSeq.
SOURCE      Physeter catodon (sperm whale)
  ORGANISM  Physeter catodon
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Cetacea;
            Odontoceti; Physeteridae; Physeter.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019873586.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Feb 23, 2018 this sequence version replaced XM_007102680.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Physeter catodon Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3974
                     /organism="Physeter catodon"
                     /mol_type="mRNA"
                     /isolate="SW-GA"
                     /db_xref="taxon:9755"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            1..3974
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:102976275"
     CDS             31..3528
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_007102742.2"
                     /db_xref="GeneID:102976275"
                     /translation="
MALFPAFAGVSEAPESGSPRKELDWLSNPSFCVGTITSLSQQTEEATAFASEESLLTRSPLKSEPSDESDTNKKPKQTSRKKKKEKKKKRKHQHHKKTKSKRGQSSSSGSESYTDSEKDRSCGNIRGSKKESEKPNQENNATADIGRHFVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDVARYKRKGDSCLGINPKKQCISWEGTSTEKKRSHKHVERYFTKKSVGLMSINGVAISSKTEPPSSESISFIPVKGAEDVVSPVTSWLNPLGIYDEATTQWLQGRGPSEQESKQPGSQPDRENVLLKAKVEEFNRRVWENPRDIQLWMAFVAFQDEVMRSPGLYAIEEGEQEKQKRSLRLVLEKKLAILERAVESNPSSVDLKLAKLQLCAEFWEPSTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIQSLYGKCLSTLSAVKDGSILSHPELPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQALVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMQQQERGGWVVVSPDDDDDEPEDEDQEIKDKTLPRWQIWLAAERSRDHRHWRPWRPEKTKKQAEEDCEDPERQVLFDDIGQSLIRLSSPDLQFRLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEKPLTFLSLSFSGVSCVGRTDQLGCRHWTRGHSREGEEFIRSIFHLVMPLFSGKERSQLCFSWLRYEIAKVVWCLHTKNKKRLKSQGKNCKKLAKNLLKEPDNRNNFGLWKQYAHLEWLLGNTEDARRVFDTALSIAGSRELKDHELCELGLLYAELEVELLPDVRGAASARAIHVLTRLTENGAYGPYTGQVLAVHILKARKAYEHALQDCLGESCVSDPAPADSFSRLISLVKCFMLFQYLTIGIDAAVRIYEQVFAKHKISVSAEGPGLEGSASPQNLSGVLEAVTLMHTSLLRFHMKVAVYPLAPLREALSEALKLYPGNQVLWRSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRVDGREVYATIPETGLTHRIRALFENAMRSDYGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYLDAVEYFPDEMQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    970..1788
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
tggagtgaaaaggcggtgcggcctgttatcatggcgctgttccccgcctttgcgggtgttagtgaggcgcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttggaaccataacatctctgagccaacaaactgaagaggccacagcctttgcttctgaagagtcgctactgaccaggagtcctctgaagtcagagccttcagatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaagaaaaccaagagtaaacgtgggcagtccagtagcagtggatctgagtcatatactgattctgaaaaggacagatcttgcggaaacatcagaggcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagtgtgggattaatgagcattaacggagttgccattagcagtaaaactgaacctccctcatcggagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaagctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaggaatccaagcagcccggttcacagcccgacagagagaacgtgcttctcaaggccaaggtggaggagtttaacaggagggtttgggagaatcctcgagatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgagaagtccgggcctgtacgccatcgaggaaggagagcaggaaaagcagaagcggtccctgaggctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcgccgagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccctgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccctggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtcgaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgaggaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccagagaggcaggtgttgtttgatgatattggacagtctctgatccgactttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaaaagcccttgacttttctcagcctttcattttccggcgtcagctgtgtcggacgcacggaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcagcatcttccacctcgtgatgcctttgttttcaggcaaggagaggtctcagctctgcttctcctggttacggtacgagattgcaaaggtcgtttggtgtctgcacactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctccttaaggagccagacaaccgcaacaactttggcctctggaagcagtatgcacatctggagtggctgctcggcaacacagaggacgccagaagagttttcgatacagcgctcagcatagcagggagcagagaactgaaggaccatgagctgtgtgagctcggtctcctctacgccgagctggaggtggagctgttgccggacgtgagaggggccgcctcagcccgagccattcatgtattgaccagactgaccgagaacggggcctacgggccctacaccgggcaagtcttggccgttcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctccgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgcgaaacacaagatctctgtttccgcagagggccctggcctggagggcagtgccagcccccagaacctgagcggtgtcctcgaggccgtcaccctgatgcacacgagcctgctcagattccacatgaaagtcgccgtctaccctctggcgcctctgcgagaggctctctcggaggctttaaagttgtatccgggcaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgtttgcaattgaagctgagaaaatgaggaaaagactagtggaaacggtgcagagggtagatggtagagaggtctacgccaccattcctgagaccggcctgacgcatcggatcagagccctatttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtacttgaattttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtgctgtacctggatgccgtggagtacttccccgatgagatgcaggagatcctggacctgatgacggagaaggagctccgggtgcgcctgccgctggaggagctggagcttctgctcgaggactagagaccaggaggggagtggggcgtgtctccggggcctccgcgcctgccccgtgggagccaggagataccagacgagacggtgacacatgcgtgtgagcgtgttaagacctctgcctttggagtttctttcttgatagtttgtgtctgggttattggtctctcacctcttgcacattttttgcgtgtgcaaatgacacaaaagccattgtttttcatattatatatgtatgtgtatatatgtgcatagacaggaatcatgctgagtgataactgaacctgtcatggttggtgtgtgagttctcgtttggtccattcttcccctgcccagccagtgccagccctgctggggtgaatgtaccttctcggttggcatccttggtggtcctgccaggtctcctgggtcttgcagtcaaaaaaaaggtctggttactcaatactaggacttcc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]