GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 04:25:20, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_006791716            5633 bp    mRNA    linear   VRT 24-AUG-2020
DEFINITION  PREDICTED: Neolamprologus brichardi argonaute RISC component 1
            (ago1), mRNA.
ACCESSION   XM_006791716
VERSION     XM_006791716.1
DBLINK      BioProject: PRJNA232513
KEYWORDS    RefSeq.
SOURCE      Neolamprologus brichardi
  ORGANISM  Neolamprologus brichardi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Cichlomorphae; Cichliformes;
            Cichlidae; African cichlids; Pseudocrenilabrinae; Lamprologini;
            Neolamprologus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006272022.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Neolamprologus brichardi Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5633
                     /organism="Neolamprologus brichardi"
                     /mol_type="mRNA"
                     /isolate="N.brichardi 1_Salsburger"
                     /db_xref="taxon:32507"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..5633
                     /gene="ago1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 43 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:102789100"
     CDS             453..3029
                     /gene="ago1"
                     /codon_start=1
                     /product="protein argonaute-1"
                     /protein_id="XP_006791779.1"
                     /db_xref="GeneID:102789100"
                     /translation="
MEPGPSGAVPMGVFPPPLQQVFHAPRRPGMGTVGKPIRLLANYFEVEIPKMDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQLFGDRKPVYDGKKNIYTVLALPIGSEKVDFEVTIPGEGKDRIFKVSIRWLAKVSWRLLQETLVSGRLQVPLDSVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKTLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNANFNLDPYIQEFGIKVKDDMAEVMGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKSERIGKSGNIPAGTTVDTSITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHVSGQSNGRDPQALAKAVQIHHDTLRTMYFA"
     misc_feature    459..3023
                     /gene="ago1"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    1623..2900
                     /gene="ago1"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2034..2036,2046..2048,2082..2093,2100..2102,
                     2124..2126,2133..2135,2145..2147,2157..2159)
                     /gene="ago1"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2238..2240,2244..2246,2454..2456,2868..2870)
                     /gene="ago1"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ttcagattttttgaggggggctaggggctggccttttttgttccgctggagagtcctgcttgaacggtgagcaggagcacaacagaacggcaagaaactacagcgccgcggaccatcggctaaatcagagcaccgggaaggatcccgctgcgccgccgaggaagagtggttcgaaataggacggcatcgccctgcagctgcgccgttactggctatagggtcaacgggcagacgagcaactggcagctatcggcgttagccttaactcctctgcgggtctgggggggttctggtaggggcagggggcgggggtacaccgagaaaggagaagactgcacgccgagaggagggggctggaagtctgagacgcttccagcctgaagggggccggcggtttggccacagcaccccccggactagctagcttgtacccgcgcggctaagtgaatgggatggagccgggaccgtctggcgctgtgcccatgggggtcttccccccacccctgcagcaggtgttccatgcccctcgccggccaggcatgggtaccgtgggcaagcccatcaggctgctggccaactactttgaagtggagatcccaaagatggatgtctatcactatgaggtggacattaagcctgacaagtgcccacgacgagtcaacagagaggtggtggagtacatggtgcagcacttcaagccccagctctttggtgacaggaagccagtgtacgatggcaagaagaacatctacacagtgctagcacttcctattgggagtgagaaggtagattttgaggtgacgattcctggcgaaggaaaggatcgaatcttcaaggtgtccatccgttggctggccaaggtgtcatggcgcctgctgcaggagactctagtcagtggccgactgcaggtcccccttgactcagttcaagccctggatgtggccatgcgtcacctggcctctatgaggtacacaccagtgggccgatcatttttctccccacctgaaggatactaccacccacttggtgggggaagggaagtttggtttggcttccaccaatcagtgcgtcccgccatgtggaagatgatgcttaacattgatgtgtctgccacggctttctacaaagcccagcctgtaattgagttcatgtgtgaggttttggacattcgcaacattgatgagcaacccaaaaccctcactgactcacaaagggtccgcttcaccaaggaaattaaaggcctgaaggtggaggtgacccattgtggccaaatgaaaagaaagtatcgtgtatgcaatgttaccagacgtcctgccagccaccaaacgtttccccttcagcttgaaagcgggcagacagtagaatgtacagtggctcagtacttcaagcagaagtacaacttgcagctcaaatacccccacctaccctgtctacaggtggggcaggagcagaaacacacctacctgcctctggaggtgtgtaatattgtagccggtcaacgatgcatcaagaaactgacagataatcagacctcaactatgattaaagccacagctcgctccgcaccggacaggcaagaggagatcagcagactgatgaagaatgccaacttcaacctggacccgtacattcaggagtttgggatcaaggtgaaggatgacatggccgaggtgatgggcagagtattgccagcccctattctgcagtacggaggacggaaccgtgccatagctacacccaaccagggagtgtgggacatgagagggaagcagttttataatggcattgagatcaaagtgtgggctattgcctgctttgccccgcagaaacagtgcagagaagaggtgctcaagaacttcacagaccagcttcgtaaaatctcaaaggatgctgggatgccaattcagggccagccatgcttctgtaaatatgcccagggagcggacagcgtggagcccatgttcagacacctgaaaaacacatactctggacttcaactcatcatcgtcatcctgccaggaaaaactcctgtctatgcggaggtaaagcgtgtgggtgacaccctcctcggcatggccacgcaatgtgtccaggtgaagaatgtggtgaagacgtcgccgcagactctgtccaacctctgcctcaaaatcaatgtgaagctgggagggatcaacaacatcctggtacctcaccaacggtcagcagtgtttcagcagccggttatcttcctgggagcagatgtcacacaccccccggctggagatggcaagaagccctccattactgctgtggtaggcagtatggatgcccatcccagcagatactgtgccacagtgcgcgtccagagacccaggcaggaaatcatcgaagatttatcttacatggtgcgcgaactgctgattcagttctacaagtcaacccgcttcaagcccaccaggatcattttctacagagacggtgttcctgagggacagttgcctcagattctccactacgagctgttggccatcagagatgcgtgcataaagttggaaaaggactatcagcctggtatcacctacatcgtggtgcagaaacgtcaccacacacgcctcttctgtgctgataagtctgaaaggattgggaagagtgggaacattcctgcagggactacagtggacaccagcatcactcatcccttcgagtttgacttctacctgtgtagtcatgcaggaatacagggcaccagccggccgtctcattattacgtcttatgggacgacaatcgcttcacagctgatgagttgcagattctaacctaccagttgtgccacacttacgtgcgctgtacccgctcagtctccatccctgccccagcctactatgctcgtctcgtggccttccgtgcccgctaccatctggtagacaaagaacatgacagtggagagggcagccatgtgtccggtcagagtaacggtcgggatccccaggcgttggctaaggctgttcagattcatcacgacactctgaggaccatgtacttcgcctgagcgtcaccaaccatcgccgccatcgttccctcccacctcatttctacctgagtgggcaaacggcccaccggcaccacctcatccccatcccttactccctacaattgcccactacacatacttcacagcaatcagtcactcaaatccaagaaacacaaatcccctctcctgtaaaacacaggtagactctgcagcctcatgcactcaaaaggttatgaatattactgttatttttactttaccgggactattgatctttttaagttgaattttgaaatcatgggtattatgtaattgtattgtatgctaccttcacactcctatgtatgtaagtatgcaatacggatgggagaaaaatagaaaactaggcgataaaaaggagaaaaaaaatcctaaaaacttttttaactgccaccacgatgctgcctctacccatccaaatgccggatgccagtattgcaagccccttgttagaggggatcctcattagaggtggtactgggcacgcacacttacatgtatcattttaatgttatcatgaactacattcatgttttttaatgtttttgaaaactgttttttttttaaacagccttgaggagtctggggtatggtacattagcacttagtgttagcatgtaggtgccaccagtcctgcacataaagagtttgttagtacatgcgaggctagccctctggtctttatattatagcagacaaagaaagagcaggtgtagcatattgtagatccaggacaggagtcctgccacacactctgtcctggttggccagtcccttagagatttcgcctttagaggcaagtttagcgtaacagtagagggaccatttgcatagtgtgtatctaatatacttgcaccccatgcacctaaaccagcattgttaaccagccaaaagtgatgccaccctatggaaagggggcactcaaacaggaagataatcttttatttctctatacatcgctcttttagaatttacgaggcactttttaaattttacttttattttattttacttcaaaatggtgaaactagccgttggcgagactttacactctacatttgaacgtttcacacccacacttgcgtagctttcagaacaaaggcaataggcaaggtcaacactattctgtagatttaaaagcaggcaaatatagtctatgatcacttaagtgctgcaaagctgaagtcgccttcagcaactgaccttgctccgatccgtctgcacattccaatgtgtatcagtggaaatggtgccaagcggcgcgctccacgcatccacccgtgcttttctttgcctaactgtaccaacctatcctgcgcctgtcccgcttttacacagagctcttcccctctgcaggcatttacaacagaagcacacacatgcctgcgctctcagtctccttctcagcatgcagagacatagctgatcaaatgcacttgttccccccattcccacgtgaagccaaactcatcaacctttccgccatcaccttttatccttgccgtctgttctcactcgtcgcataacacacctgcagcatcccctgccccaatcccctatgttgtgttagccaatccctattggtgctctgtgtgcgtgggcggcacagataggggattgctacatttgacagggtgggcctctattacgactatttaacatgccctgcctttacatctagtcactttctggatttatggaagaaaaatgcatgtaattattttttatgactggatattctgagccaccttactttggttttcttagaggtaggagcctcgcgctcaccactgcctgtcagtcgttttgcctcgattgtgtaatggttataaagactgcttttttcctttgtcattattattatgaatattgtgactagtgtcagagtgtatcctcaagagggcactgtggagacggtcccaaaattccacctcagttgccctttaagcgcctcaaatcttgtctgatggtcagacccccttttgagtcgaaagggatcaaaagataagagatcagatgagtttgatttttaaatcatgtttatgaacttgcataatcaaaatgcctttgtacaccgttttactgatccttcattgtgtccacggtgatttgtatatatgaatatataatattaacctgttatgtattttggcccagcagttgaggggcttttcacagtcggggccagtcttctacccctcattctgcgtttaaaaaaagaaagaaagaaagaaagacaggaaaaatatcaacctgggggcatttccccaacaccactgaaaccagatgcagttcttcactcactgaagccacaaagcaccttgcaaaggggggagacgaaatggcagtcaccctggaaatgtatcatgtggacacgggagagtccgttccccctccacgcagcctcacggtctgactaagcaatattgaagccactgatcaagaacagtccttgtcatagcacttcccaatagatttgaatgaaaggacgtggaagcatattattttggctctgtatgtgatagtatgggaactctgttggggagggttattttttaaagaaaataaaattgttttttatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]