GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:13:04, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_006748057            3847 bp    mRNA    linear   MAM 30-SEP-2019
DEFINITION  PREDICTED: Leptonychotes weddellii NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), mRNA.
ACCESSION   XM_006748057
VERSION     XM_006748057.2
DBLINK      BioProject: PRJNA232772
KEYWORDS    RefSeq.
SOURCE      Leptonychotes weddellii (Weddell seal)
  ORGANISM  Leptonychotes weddellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Phocidae; Leptonychotes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006385806.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 30, 2019 this sequence version replaced XM_006748057.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Leptonychotes weddellii Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3847
                     /organism="Leptonychotes weddellii"
                     /mol_type="mRNA"
                     /isolate="WS11-02"
                     /db_xref="taxon:9713"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
     gene            1..3847
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 mRNAs, 2 Proteins, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 5 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102735624"
     CDS             73..3579
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_006748120.1"
                     /db_xref="GeneID:102735624"
                     /translation="
MALFPAFAGIGDAPNSGSARKELDWLSNPSFCVGAISSLSQQPEEAATLVSEGSPLTRSPLKSEPSDESDANGKPKQTSRKKKKEKKKKRKRHHKKTKRKRGQAGSSGSEPDSEPEEDKTSRSTGDSRRESEKPSQEGNAAADIGHRFVWLEDVQALTGETFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWERAAAEKKPSHKRVERYFTKKSVGLMNIDGVAVGSKTEPPSSEPISFIPVKGSDDVVPPVTTWLNPLGIYDPSTTQWLQGQGPPEQESKQPDSQTDRERALLKAKVEEFNRRVRENPHDIQLWMAFVAFQDEVVRSPGLYALEAGEQEKRKRSAKLVLEKQLAVLERAIESNQSSVELQLARLKLCAEFWEPSALLREWQKLIFVHPNSTALWQKYLLFCQSQFSTFTVSKIHGLYGKCLSTLSAVQDGSILSHPALPGTEEAVFALFLQHCHFLRQAGHSEKAISLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMHQQERGGWVVISPDDDDDEPEDEDQEIRDKSLPRWQIWLAAERSRDQRHWQPWRPDKTKKQTEEDCEDPERQVLFDDIAQSLIQLSSRDLQFQLVAAFLQFLGVPSGLSPLASCLYLAMDEDSIFDNGLHDEKPLTFLDLSFSGVSCVGRSDPLGCHRWTRGHNREGEEFIRNIFHLVMSLFSGQERSQLCFSWLRYEMAKVVWCLHTKNKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDTALSLAGGGEPRGCEPWELGLLYAGLELELELELSPAARGAATARAVHILTRLTENGPYAPYSGPVSAVHVLKARKAYEHALQDCQGQSCGAGPPPADASHRLAGLLRCFMLFQYLTVGIEAAVRIYEQACAQLQGSVSPGGCGPDEPSCAQSPGRGLEAVTLMHTSLLRFHARVSVCPVAPLRQALSDALRWYPGNQVLWRAYVQLQSKSHTASKTRRFFDAITRSAKPLEPWLFAIEAEKTRKRLVETVQRVDGREVHATIPETGLTHRIEALFENALRSDNGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKTLYLDAVGHFPEEMQEVLDLMTEKELRVRLPVEELELLLED"
     misc_feature    1009..2007
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
gcgggcctcactaccggcgtccgctcgccggcgccatttctgtcgaggggaacggcagtgcggcctgtgatcatggcgctgttcccggcctttgccggtattggtgacgctcccaacagcggcagcgccaggaaagaattagattggctgagcaacccgagcttttgtgttggagccataagctctctgagccaacaacctgaagaggctgccactctggtttctgaagggtcaccgctgacgaggagtcctctgaaatcagagccttcagatgaaagtgatgctaacggaaagcccaaacaaacaagcagaaaaaagaagaaagagaagaagaagaagaggaaacgtcaccacaagaaaaccaagagaaaacgtgggcaggccggtagcagtggctccgagccggatagtgagcctgaagaggacaaaacttccagaagcactggagacagtagaagggaatcggagaaaccaagtcaagaaggtaatgctgccgctgatattgggcatcgctttgtttggcttgaggacgttcaggctctgactggagaaaccttcagaacagataagaaaccggatccggccaactgggagtataagtctctctaccgaggagacatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgtatatcctgggagagggctgccgcagaaaagaagccttcacacaagcgtgttgagcgctatttcacgaagaagagcgtgggcttaatgaacattgacggagttgccgttggcagtaaaaccgaacctccctcatctgagccgatctcgtttatccccgtgaagggctcggatgatgtggttcctcccgttacgacctggttgaaccctctggggatttacgatccgtccaccacgcagtggttacaaggacagggccctccagagcaagaatcaaagcagccagactcccagacagacagagagcgcgcgctgctcaaggccaaggtggaggagttcaacaggagagtgcgggagaaccctcacgatattcagctgtggatggcgttcgttgcttttcaggacgaggtcgtgcggagccccggcctgtatgccctggaggcaggggagcaggagaagcggaagaggtctgcgaagctggtgctggagaagcagctggctgtcctggagcgggccatcgagagcaaccagagctccgtggagctgcagctggcccggctgaagctgtgcgccgagttctgggagccctcggcgctgctcagggagtggcagaaactgatctttgtacaccccaacagtacggccctctggcagaagtaccttttattttgccaaagccagttcagcaccttcaccgtgtcgaagatccacggtctttacggcaaatgcttgagcactctgtccgcggtgcaggacggcagcatcctgtcgcaccccgccctgcccggcaccgaggaggccgtgttcgctctctttcttcagcactgtcacttcctgcggcaggccggtcactcggagaaggcgatctcgctcttccaggccatggtggacttcaccttcttcaagccagacagcgtgaaagacctgcctaccaaaggacaggtggaattctttgagcccttctgggacagtggggagccccgggctggggagaagggcgcccgaggctggagagcctggatgcaccagcaggagcgaggcggctgggtggtcatcagtccagatgatgatgatgacgagccagaagacgaggaccaggaaataagagataagagtctgcccaggtggcagatctggctcgccgctgagcggtcccgagaccagagacactggcagccgtggcgccctgataagaccaagaagcaaaccgaagaagactgtgaggacccagagagacaggtgctgtttgatgacattgcgcagtctctgatccagctctccagccgggatcttcagtttcagctggtcgcggcctttctgcagttcctgggcgtgccttctggcctcagccccctggcctcctgcctctacctggccatggacgaggacagcatcttcgataacgggcttcacgatgaaaagccattgacttttctcgacctgtccttttccggcgtcagctgtgttggccgttcagacccactgggctgccatcgctggacccgcgggcacaatcgagagggcgaggagttcatccgtaacatctttcaccttgtgatgtctctgttttcaggccaggagaggtctcagctctgcttctcctggctacggtacgagatggcgaaggtcgtttggtgtctgcacactaaaaacaagaagaggttaaagtcacaaggaaagaactgcaaaaaacttgccaaaaacctcctgaaggagccagaaaaccgcaacaacttttgcctctggaagcagtacgcacatctggagtggttgctcggcaacaccgaggacgccaggaaggtgttcgacacggcgctcagcctggcggggggcggagagccgcggggctgcgagccctgggagctcggcctgctctacgcggggctggagctggagctggagctggagctgtcgccggccgcgagaggggccgccacggcccgagctgtccacatactgaccaggctgacggagaatggtccctacgcgccctactccgggccggtctcggctgttcacgttttgaaggcccggaaggcttacgaacacgcgctgcaggactgtcaggggcagagctgtggcgctgggccgcctcccgccgacgcctctcaccgcctcgccggcctgctcaggtgcttcatgctcttccagtacttgaccgtggggatcgaagccgctgtgcggatctacgagcaggcgtgtgcgcagctgcagggctccgtctccccgggcggctgtgggccggacgagcccagctgcgcgcagagcccgggccgcggcctcgaggccgtcacgctgatgcacacgagcctgctgcggttccacgcgagggtcagcgtgtgccccgtggctcctctgcggcaggcgctctcggacgccttacggtggtaccccggcaaccaggttctgtggcgggcctacgtacagcttcagagtaagtcccacacggccagtaagaccagaaggttcttcgatgccattaccaggtctgccaaacccttggagccgtggttgtttgcgattgaagccgagaaaacgaggaagaggctggtggaaaccgttcagagggtggatggcagagaggtccacgccacgattcccgagaccggcttgacgcatcggatcgaagccctgtttgaaaatgctttgcggagcgacaacggcagccagtgccccttactgtggagaatgtatttgaactttctggtctccttgggaaacaaagaaaggagcaaaggcgtgttctacaaagcacttcagaattgtccttgggcaaagacgctgtacctggatgccgtgggccacttccctgaagagatgcaggaggtcctggacctgatgacggagaaggagctccgggtgcgcctgcccgtggaggagttggagcttctactcgaggactagagaccaggaggtgttcaacagtccctgccttccgggcctcgtcgcctgcaccgctggggccgggatgtagcagacggggcacgtgtaggtgcatgtgttccaggagctctgctttccaagtctagctttaattcttagtaatttgaacctgggtcatcagtttcttagctcttgcacattttttggatgtgcaaataacacagaagctattgcttacatattatatatgtgaatgtgtaggtaagaatcatgccccatgacaatggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]