LOCUS       XM_006740477            4441 bp    mRNA    linear   MAM 30-SEP-2019
DEFINITION  PREDICTED: Leptonychotes weddellii ATPase copper transporting beta
            (ATP7B), transcript variant X5, mRNA.
ACCESSION   XM_006740477
VERSION     XM_006740477.2
DBLINK      BioProject: PRJNA232772
KEYWORDS    RefSeq.
SOURCE      Leptonychotes weddellii (Weddell seal)
  ORGANISM  Leptonychotes weddellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Pinnipedia; Phocidae; Monachinae; Lobodontini; Leptonychotes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006384224.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 30, 2019 this sequence version replaced XM_006740477.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Leptonychotes weddellii Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4441
                     /organism="Leptonychotes weddellii"
                     /mol_type="mRNA"
                     /isolate="WS11-02"
                     /db_xref="taxon:9713"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
     gene            1..4441
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 mRNAs, 4 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:102730267"
     CDS             143..4441
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_006740540.1"
                     /db_xref="GeneID:102730267"
                     /translation="

MKQSFAFDNVGYEGGLDGVCPPQMTSSTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSILSLPQICRHIEDMGFEASIAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGRLGKLQGVVRVRVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTDPKTPSASDNQNLNNSEPSGHHGSHVVTLQLRVDGMHCKSCVLNIEENIGPLPGVQNIQVSLENRIAQVQYDPSRITADALQRAIEALPPGDFKVSLPDGAAGGGAGSRSSDRAAPAPAPRTQEPGVCSTVVLAIAGMTCASCVQSIEGLVSQREGVQQISVSLADGTGVVLYDPSVIHPEELRAAVEEMGFETSVLFENCYSNHVGNHSAGNSSAHPTAGVPVSVQEEAPHAGGLPKNHSPGSSSKSPQASTTAAPQKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIARLIRDLGFEAAVMEDYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEIIGARDIVRIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMLYMLVPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLRHRAANMDVLIVLATGIAYTYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGMAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSSVEGILAHGERQQSKQAAPLSRTGSVPEAIDATPQTFSVLIGNREWMRRNGLTISSDISDAMTDHEMKGQTAILVAIDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRRTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"

     misc_feature    224..415
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(242..250,257..259)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    479..667
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(497..505,512..514)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    821..997
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(839..847,854..856)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1121..1312
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1517..1705
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1532..1540,1547..1549)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1742..1933
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1760..1768,1775..1777)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1997..4105
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2990..2992,2996..2998,4034..4036)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3122..3130,3332..3334,3485..3493,3581..3583,
                     3701..3709,3767..3769,3776..3778,3785..3787,3842..3844,
                     3851..3853)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

ctgcccgagctccgaagctggctgctggacttggctggcagcctctcagcggactggctccggagcagaggggaatccgcaggacggatcacagaagatcctgtctaaagtttctctgcccgctcgtgccggggagccagcaatgaagcagagtttcgcctttgacaatgttggctatgaaggcggcctggatggcgtgtgcccccctcagatgaccagcagcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttccagcttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgaccgtgaagtacgtgccgtccatcctgagcctgccgcagatttgccggcacattgaggacatgggctttgaggccagcatcgcagaaggaaaggccgcctcctggccttcaaggtcctcgcctggcctggaggccgtggtcaagctccgggtggagggcatgacctgccagtcctgcgtcagctccattgaaggcaggcttgggaaactgcaaggggtagtgagggtccgagtgtccctcggcacccaggaagcagtcattacctaccagccttatctcatccagccccaggacctcagggaccatgtcaacgacatgggctttgaagctgtcatcaagaacagagtagcgcccgtaagcctgggacccattgatattgggcggttacagaggaccgacccaaagacaccttcggcttctgataaccagaatctcaataactctgagccctcgggacaccacgggagccacgtggtcaccctgcaactgagagtagatggaatgcactgtaagtcttgtgtcctgaatattgaagaaaacataggcccactccctggggttcaaaatattcaagtgtccttggagaacagaatcgcccaagtacagtacgacccttctcgtatcactgcagacgccctgcagagggccattgaagctcttccgcctggggactttaaagtctctcttcctgatggagcagcagggggtggggcaggtagcaggtcttccgaccgggcggcccccgcccccgccccgagaacccaggagccaggcgtgtgcagtaccgtggtgcttgccatcgctggaatgacctgtgcgtcctgtgtccagtccatcgaaggcctggtctcccagagggaaggggtgcagcaaatatcagtctctctggctgacgggaccggagtggtgctctatgatccctctgtaattcacccggaagaactccgagctgctgttgaagaaatgggatttgagacttcagtcctttttgaaaactgttacagcaaccatgttggaaaccacagtgcggggaattcctcagcgcaccccacagctggcgtacctgtgtctgtgcaggaagaggctccccatgctgggggccttcctaaaaaccacagccctggctcctcgtccaagtccccgcaagcctctaccacagcagcacctcagaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtccaacatagagagaaacctgcagaaagaagcaggtattctctcggtgctggttgccctgatggccgggaaggcagaggttaagtataacccagaagtcatccagccgctggagatagctcggctcatccgggacttgggctttgaggcggcggtaatggaagactacacaggctcagatggcgacctcgagctgatcatcacggggatgacctgcgcatcctgtgttcacaacatagagtccaaactcacaaggacaaacggcatcacctacgcgtctgtggcccttgccaccagcaaagcccacgtgaagttcgatcctgaaattatcggtgcacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaaccccaacgcgcatcacttggaccacaaggtggaaataaagcagtggaagaagtcttttctgtgcagcctggtgttcggcatccccgtcatgggtctgatgctctatatgttggtgcccagcagcgagccccacgagtctatggtgctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagctccttggcgggtggtacttctacgtccaggcctacagatctctgaggcacagggcggccaacatggatgtgctcattgtgctggccaccggcatcgcctacacctactcgctcgtcatcctggtggtggctgtggccgagaaggcggagaggagccccgtgaccttcttcgacaccccccccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgttgtgacccttggcgaggacaacttgatcatcagagaggagcaggtacccatggagctggtgcagcggggtgatatcatcaaagttgtccccgggggaaagttcccagtggatgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggagaagccatgcccgtcacgaagaaacctggaagcacagtgattgctgggtctataaatgcacacggctctgtgctcgttaatgccacccatgtgggcaatgacaccacgttggctcagattgtgaaattggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacatccatcacggtgctgtgcattgcctgcccctgctccctgggcttggccacgcccacggcagtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcccacaagataaagaccgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgagggtcctcctgcttgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccctttgggcatggcagtcaccaagtactgtaaagaggaattgggaaccgagaccttgggatactgcacggacttccaggcagtgccgggctgtggcatcggctgcaaagtcagtagcgtggagggcatcctggcccacggcgagcgccagcagagcaaacaggctgctcccctgagcaggactggcagcgttcccgaggcgatagatgcgaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacatcagtgacgcgatgacagatcatgagatgaaaggccagacggccatcctggtggccattgacggcgtgctctgcgccatgatcgccatcgcggatgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacaggggacaaccggaggacagccagagccatcgccacccaggttggcatcaacaaggtctttgcagaggtcctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaggtcgccatggtgggagatggggtcaatgactcaccagccttggcccgggctgatgtgggcattgccatcgggacaggcacggacgtcgccattgaggctgctgacgttgtcctcatcagaaacgatttgctcgatgtggtggctagcattcacctgtccaagaggaccgtctggagaatacgcctcaatctggtgctggcgttgatttataacctgatcggaatacccattgccgcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcggcggccatggcggcctcctccgtgtctgtggttctctcatcgctgcagctcaagtgctataagaagcccgacctggagaggtatgaggcgcaggcccagggccgcatgaagcccctgacggcgtcgcaggtgagcgtgcacatcggcatggatgaccggcgacgggactccccgagggccacgccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgatggtggggacaagtggtctctgctcctgaatgacagagatgaggagcagtgcatctga

//