GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 22:50:51, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_006740477            4441 bp    mRNA    linear   MAM 30-SEP-2019
DEFINITION  PREDICTED: Leptonychotes weddellii ATPase copper transporting beta
            (ATP7B), transcript variant X5, mRNA.
ACCESSION   XM_006740477
VERSION     XM_006740477.2
DBLINK      BioProject: PRJNA232772
KEYWORDS    RefSeq.
SOURCE      Leptonychotes weddellii (Weddell seal)
  ORGANISM  Leptonychotes weddellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Phocidae; Leptonychotes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006384224.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 30, 2019 this sequence version replaced XM_006740477.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Leptonychotes weddellii Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4441
                     /organism="Leptonychotes weddellii"
                     /mol_type="mRNA"
                     /isolate="WS11-02"
                     /db_xref="taxon:9713"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
     gene            1..4441
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 mRNAs, 4 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:102730267"
     CDS             143..4441
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_006740540.1"
                     /db_xref="GeneID:102730267"
                     /translation="
MKQSFAFDNVGYEGGLDGVCPPQMTSSTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSILSLPQICRHIEDMGFEASIAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGRLGKLQGVVRVRVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTDPKTPSASDNQNLNNSEPSGHHGSHVVTLQLRVDGMHCKSCVLNIEENIGPLPGVQNIQVSLENRIAQVQYDPSRITADALQRAIEALPPGDFKVSLPDGAAGGGAGSRSSDRAAPAPAPRTQEPGVCSTVVLAIAGMTCASCVQSIEGLVSQREGVQQISVSLADGTGVVLYDPSVIHPEELRAAVEEMGFETSVLFENCYSNHVGNHSAGNSSAHPTAGVPVSVQEEAPHAGGLPKNHSPGSSSKSPQASTTAAPQKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIARLIRDLGFEAAVMEDYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEIIGARDIVRIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMLYMLVPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLRHRAANMDVLIVLATGIAYTYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGMAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSSVEGILAHGERQQSKQAAPLSRTGSVPEAIDATPQTFSVLIGNREWMRRNGLTISSDISDAMTDHEMKGQTAILVAIDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRRTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"
     misc_feature    224..415
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(242..250,257..259)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    479..667
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(497..505,512..514)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    821..997
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(839..847,854..856)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1127..1318
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1145..1153,1160..1162)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1517..1705
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1532..1540,1547..1549)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1739..4108
                     /gene="ATP7B"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
     misc_feature    1742..1933
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1760..1768,1775..1777)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2348..3091
                     /gene="ATP7B"
                     /note="E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122"
                     /db_xref="CDD:278548"
     misc_feature    order(3590..3598,3701..3706)
                     /gene="ATP7B"
                     /note="active site"
                     /db_xref="CDD:119389"
     misc_feature    3590..3607
                     /gene="ATP7B"
                     /note="motif I; other site"
                     /db_xref="CDD:119389"
     misc_feature    <3659..3970
                     /gene="ATP7B"
                     /note="Soluble P-type ATPase [General function prediction
                     only]; Region: COG4087"
                     /db_xref="CDD:226572"
     misc_feature    3701..3703
                     /gene="ATP7B"
                     /note="motif II; other site"
                     /db_xref="CDD:119389"
ORIGIN      
ctgcccgagctccgaagctggctgctggacttggctggcagcctctcagcggactggctccggagcagaggggaatccgcaggacggatcacagaagatcctgtctaaagtttctctgcccgctcgtgccggggagccagcaatgaagcagagtttcgcctttgacaatgttggctatgaaggcggcctggatggcgtgtgcccccctcagatgaccagcagcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttccagcttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgaccgtgaagtacgtgccgtccatcctgagcctgccgcagatttgccggcacattgaggacatgggctttgaggccagcatcgcagaaggaaaggccgcctcctggccttcaaggtcctcgcctggcctggaggccgtggtcaagctccgggtggagggcatgacctgccagtcctgcgtcagctccattgaaggcaggcttgggaaactgcaaggggtagtgagggtccgagtgtccctcggcacccaggaagcagtcattacctaccagccttatctcatccagccccaggacctcagggaccatgtcaacgacatgggctttgaagctgtcatcaagaacagagtagcgcccgtaagcctgggacccattgatattgggcggttacagaggaccgacccaaagacaccttcggcttctgataaccagaatctcaataactctgagccctcgggacaccacgggagccacgtggtcaccctgcaactgagagtagatggaatgcactgtaagtcttgtgtcctgaatattgaagaaaacataggcccactccctggggttcaaaatattcaagtgtccttggagaacagaatcgcccaagtacagtacgacccttctcgtatcactgcagacgccctgcagagggccattgaagctcttccgcctggggactttaaagtctctcttcctgatggagcagcagggggtggggcaggtagcaggtcttccgaccgggcggcccccgcccccgccccgagaacccaggagccaggcgtgtgcagtaccgtggtgcttgccatcgctggaatgacctgtgcgtcctgtgtccagtccatcgaaggcctggtctcccagagggaaggggtgcagcaaatatcagtctctctggctgacgggaccggagtggtgctctatgatccctctgtaattcacccggaagaactccgagctgctgttgaagaaatgggatttgagacttcagtcctttttgaaaactgttacagcaaccatgttggaaaccacagtgcggggaattcctcagcgcaccccacagctggcgtacctgtgtctgtgcaggaagaggctccccatgctgggggccttcctaaaaaccacagccctggctcctcgtccaagtccccgcaagcctctaccacagcagcacctcagaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtccaacatagagagaaacctgcagaaagaagcaggtattctctcggtgctggttgccctgatggccgggaaggcagaggttaagtataacccagaagtcatccagccgctggagatagctcggctcatccgggacttgggctttgaggcggcggtaatggaagactacacaggctcagatggcgacctcgagctgatcatcacggggatgacctgcgcatcctgtgttcacaacatagagtccaaactcacaaggacaaacggcatcacctacgcgtctgtggcccttgccaccagcaaagcccacgtgaagttcgatcctgaaattatcggtgcacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaaccccaacgcgcatcacttggaccacaaggtggaaataaagcagtggaagaagtcttttctgtgcagcctggtgttcggcatccccgtcatgggtctgatgctctatatgttggtgcccagcagcgagccccacgagtctatggtgctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagctccttggcgggtggtacttctacgtccaggcctacagatctctgaggcacagggcggccaacatggatgtgctcattgtgctggccaccggcatcgcctacacctactcgctcgtcatcctggtggtggctgtggccgagaaggcggagaggagccccgtgaccttcttcgacaccccccccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgttgtgacccttggcgaggacaacttgatcatcagagaggagcaggtacccatggagctggtgcagcggggtgatatcatcaaagttgtccccgggggaaagttcccagtggatgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggagaagccatgcccgtcacgaagaaacctggaagcacagtgattgctgggtctataaatgcacacggctctgtgctcgttaatgccacccatgtgggcaatgacaccacgttggctcagattgtgaaattggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacatccatcacggtgctgtgcattgcctgcccctgctccctgggcttggccacgcccacggcagtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcccacaagataaagaccgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgagggtcctcctgcttgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccctttgggcatggcagtcaccaagtactgtaaagaggaattgggaaccgagaccttgggatactgcacggacttccaggcagtgccgggctgtggcatcggctgcaaagtcagtagcgtggagggcatcctggcccacggcgagcgccagcagagcaaacaggctgctcccctgagcaggactggcagcgttcccgaggcgatagatgcgaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacatcagtgacgcgatgacagatcatgagatgaaaggccagacggccatcctggtggccattgacggcgtgctctgcgccatgatcgccatcgcggatgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacaggggacaaccggaggacagccagagccatcgccacccaggttggcatcaacaaggtctttgcagaggtcctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaggtcgccatggtgggagatggggtcaatgactcaccagccttggcccgggctgatgtgggcattgccatcgggacaggcacggacgtcgccattgaggctgctgacgttgtcctcatcagaaacgatttgctcgatgtggtggctagcattcacctgtccaagaggaccgtctggagaatacgcctcaatctggtgctggcgttgatttataacctgatcggaatacccattgccgcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcggcggccatggcggcctcctccgtgtctgtggttctctcatcgctgcagctcaagtgctataagaagcccgacctggagaggtatgaggcgcaggcccagggccgcatgaagcccctgacggcgtcgcaggtgagcgtgcacatcggcatggatgaccggcgacgggactccccgagggccacgccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgatggtggggacaagtggtctctgctcctgaatgacagagatgaggagcagtgcatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]