GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:09:17, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_006712872            4192 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens GRIP and coiled-coil domain containing 2
            (GCC2), transcript variant X8, mRNA.
ACCESSION   XM_006712872
VERSION     XM_006712872.3
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000002.12) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 6, 2016 this sequence version replaced XM_006712872.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4192
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
     gene            1..4192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="GRIP and coiled-coil domain containing 2; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 mRNAs, 52 ESTs, 132 long SRA reads, 4 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 68 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
     variation       5..7
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="cgg"
                     /db_xref="dbSNP:1399229719"
     variation       5
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3806530"
     variation       6
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:904488634"
     variation       13
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470380482"
     variation       17
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239949363"
     variation       21
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191591909"
     variation       26
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467662749"
     variation       31
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000281662"
     variation       33
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558721363"
     variation       38..41
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:563310672"
     variation       39
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031793959"
     variation       41
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1223098009"
     variation       43
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975922254"
     variation       52
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914641102"
     variation       57
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:956310041"
     variation       58
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779872337"
     variation       73
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558721384"
     variation       94
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301924850"
     variation       99
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440757954"
     variation       102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184423805"
     variation       103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:867203048"
     variation       106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924561985"
     variation       107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1879496"
     variation       108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057012938"
     variation       111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974937140"
     variation       113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217125717"
     variation       116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453773219"
     variation       120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948555068"
     variation       124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478939902"
     variation       126
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920937951"
     variation       129
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192486724"
     variation       132..133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:1189492612"
     variation       134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037444456"
     variation       136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216015261"
     variation       141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322730695"
     variation       142
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278704418"
     variation       144
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424558970"
     variation       145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:898914417"
     variation       153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349323277"
     variation       154
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304028993"
     variation       157
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543567516"
     variation       167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361274912"
     variation       171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289697268"
     variation       172
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993163797"
     variation       174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952343119"
     variation       176
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373845882"
     variation       179
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310883928"
     variation       182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868124694"
     variation       189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984192095"
     variation       195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419437007"
     variation       196
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908323091"
     variation       197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187685645"
     variation       201..202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1361998154"
     variation       204
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890095195"
     variation       213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056990307"
     variation       214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:917056492"
     variation       217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948623670"
     variation       218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254957230"
     variation       225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210694998"
     variation       226
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486168929"
     variation       229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019841172"
     variation       234
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044295254"
     variation       242
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193105428"
     variation       244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1307016496"
     variation       245..246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:35013018"
     variation       246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296446681"
     variation       252
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1220506161"
     variation       253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759937825"
     variation       254..259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1292841906"
     variation       254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1413948007"
     variation       259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204883487"
     variation       269
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975565365"
     variation       281
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053515027"
     variation       282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891909008"
     variation       288
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170856626"
     variation       292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009368311"
     variation       298
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217010989"
     variation       302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466722491"
     variation       307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415224304"
     variation       313
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565443224"
     variation       315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021752074"
     variation       317..322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaga"
                     /replace="gagaga"
                     /db_xref="dbSNP:3840470"
     variation       319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258638971"
     variation       325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019130560"
     variation       328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219639245"
     variation       329
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964810066"
     variation       332
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770233829"
     variation       335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200665660"
     variation       339
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488829817"
     variation       344
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996392192"
     variation       348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027894803"
     variation       349..353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ctc"
                     /replace="ctctc"
                     /db_xref="dbSNP:1193023391"
     variation       349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558721573"
     variation       350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:952294284"
     variation       367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:993169878"
     variation       369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:983826034"
     variation       372
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908188967"
     variation       376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961164638"
     variation       379
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389461468"
     variation       382
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992950601"
     variation       393
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331890143"
     variation       397
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159555211"
     variation       398
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948596873"
     variation       405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391595486"
     variation       408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574195450"
     variation       409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322442761"
     variation       410
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532785631"
     variation       420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437944507"
     variation       425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929067399"
     variation       428..429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1239325720"
     variation       430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047442050"
     variation       431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467213291"
     variation       434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375991096"
     variation       435
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210479999"
     variation       436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890136581"
     variation       438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1259174871"
     variation       439..441
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:1489824646"
     variation       439
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236635771"
     variation       449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1008546160"
     variation       456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309920728"
     variation       457
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041722614"
     variation       460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1311461176"
     variation       461
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368665713"
     variation       464
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324680388"
     variation       466
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /replace="aaggcccaggggtcaa"
                     /db_xref="dbSNP:5833288"
     variation       468
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1044249469"
     variation       469..488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="cccaggggtcgagccccagg"
                     /replace="cccaggggtcgagccccaggggtcgagccccagg"
                     /db_xref="dbSNP:1250087571"
     variation       470
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925885155"
     variation       472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286697089"
     variation       473
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935903872"
     variation       474
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559700635"
     variation       476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227582730"
     variation       479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762749944"
     variation       481
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115402993"
     variation       482
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536639986"
     variation       484
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998950724"
     variation       487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751187058"
     variation       491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900585831"
     variation       492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031731796"
     variation       494
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259924821"
     variation       495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142672792"
     variation       496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770529762"
     variation       498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457421293"
     variation       499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992836939"
     variation       503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185842764"
     variation       508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179794074"
     variation       509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286530149"
     variation       510
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775901303"
     variation       513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:952324921"
     variation       515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189309951"
     variation       517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471998572"
     variation       522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233356604"
     variation       523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005514978"
     variation       525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414015072"
     variation       526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300510031"
     variation       528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015264881"
     variation       529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558444164"
     variation       530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173607579"
     variation       531
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1479064039"
     variation       532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970005984"
     variation       534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398914201"
     variation       535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478292563"
     variation       538
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766884787"
     variation       540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218590911"
     variation       541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333262230"
     variation       542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920442932"
     variation       545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338659642"
     variation       548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347009425"
     variation       552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249157721"
     variation       553
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750418518"
     variation       565
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340810302"
     variation       568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969778698"
     variation       570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047493751"
     variation       571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1413330941"
     variation       573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979962639"
     variation       574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357238873"
     variation       579
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147355200"
     variation       582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335471563"
     variation       585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779885564"
     variation       589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416696822"
     variation       592..597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:944403618"
     variation       592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935951664"
     variation       597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989095657"
     variation       599
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256461594"
     variation       600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426065596"
     variation       605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913239792"
     variation       606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479371785"
     variation       608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558721835"
     variation       609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900127381"
     variation       610
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236732921"
     variation       620
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199391198"
     variation       624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187964358"
     variation       629
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:534536327"
     variation       631
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248315422"
     variation       632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040349590"
     variation       634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259630251"
     variation       635
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231018438"
     variation       637
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:553030659"
     variation       641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904708033"
     variation       642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441218760"
     variation       644
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530992367"
     variation       653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900616886"
     variation       662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574492010"
     variation       663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474016978"
     variation       664
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200624188"
     variation       667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1255127111"
     variation       667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454919416"
     variation       669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747693822"
     variation       670..675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agcggt"
                     /replace="agcggtagcggt"
                     /db_xref="dbSNP:1162852987"
     variation       670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393404342"
     variation       671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771544904"
     variation       672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032200284"
     variation       674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541919188"
     variation       675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1473625015"
     variation       675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764691463"
     variation       676..704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ggcggcgg"
                     /replace="ggcggcggctggttgcgggccggcggcgg"
                     /db_xref="dbSNP:769865848"
     variation       676
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460800506"
     variation       677
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558721939"
     variation       678..702
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="cggcggctggttgcgggccggcggc"
                     /replace="cggcggctggttgcgggccggcggctggttgcgggccggcggc"
                     /db_xref="dbSNP:1374347716"
     variation       679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759956198"
     variation       679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gccag"
                     /db_xref="dbSNP:1558721960"
     variation       682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014717464"
     variation       686..704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggttgcgggccggcggcgg"
                     /db_xref="dbSNP:1441240714"
     variation       686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765637800"
     variation       687
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230400164"
     variation       688
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887917053"
     variation       689..699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgcgggccggc"
                     /db_xref="dbSNP:1348902900"
     variation       690..706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcgggccggcggcgggc"
                     /replace="gcgggccggcggcgggccggcggcgggc"
                     /db_xref="dbSNP:1368187862"
     variation       691
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370365824"
     variation       692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575208339"
     variation       695
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306778516"
     variation       696
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920494835"
     variation       697..712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ggcgg"
                     /replace="ggcggcgggctggcgg"
                     /replace="ggcggcgggctggcggcgggctggcgg"
                     /db_xref="dbSNP:776397797"
     variation       697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896734136"
     variation       699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274881264"
     variation       700
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013954399"
     variation       701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213350683"
     variation       702
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1023965750"
     variation       704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477374361"
     variation       705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544110704"
     variation       706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246928493"
     variation       711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751810629"
     variation       714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757471595"
     CDS             715..3648
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /codon_start=1
                     /product="GRIP and coiled-coil domain-containing protein 2
                     isoform X4"
                     /protein_id="XP_006712935.1"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
                     /translation="
MEVTQDLVQDGVASPATPGTGKSKLETLPKEDLIKFAKKQMMLIQKAKSRCTELEKEIEELRSKPVTEGTGDIIKALTERLDALLLEKAETEQQCLSLKKENIKMKQEVEDSVTKMGDAHKELEQSHINYVKEIENLKNELMAVRSKYSEDKANLQKQLEEAMNTQLELSEQLKFQNNSEDNVKKLQEEIEKIRPGFEEQILYLQKQLDATTDEKKETVTQLQNIIEANSQHYQKNINSLQEELLQLKAIHQEEVKELMCQIEASAKEHEAEINKLNELKENLVKQCEASEKNIQKKYECELENLRKATSNANQDNQICSILLQENTFVEQVVNEKVKHLEDTLKELESQHSILKDEVTYMNNLKLKLEMDAQHIKDEFFHEREDLEFKINELLLAKEEQGCVIEKLKSELAGLNKQFCYTVEQHNREVQSLKEQHQKEISELNETFLSDSEKEKLTLMFEIQGLKEQCENLQQEKQEAILNYESLREIMEILQTELGESAGKISQEFESMKQQQASDVHELQQKLRTAFTEKDALLETVNRLQGENEKLLSQQELVPELENTIKNLQEKNGVYLLSLSQRDTMLKELEGKINSLTEEKDDFINKLKNSHEEMDNFHKKCEREERLILELGKKVEQTIQYNSELEQKVNELTGGLEETLKEKDQNDQKLEKLMVQMKVLSEDKEVLSAEVKSLYEENNKLSSEKKQLSRDLEVFLSQKEDVILKEHITQLEKKLQLMVEEQDNLNKLLENEQVQKLFVKTQLYGFLKEMGSEVSEDSEEKDVVNVLQAVGESLAKINEEKCNLAFQRDEKVLELEKEIKCLQEESVVQCEELKSLLRDYEQEKVLLRKELEEIQSEKEALQSDLLEMKNANEKTRLENQNLLIQVEEVSQTCSKSEIHNEKEKCFIKEHENLKPLLEQKELRDRRAELILLKDSLAKSPSVKNDPLSSVKELEEKIGKNRLERGKLLLQKKEGELLL"
     misc_feature    844..3582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="Chromosome segregation ATPase [Cell cycle control,
                     cell division, chromosome partitioning]; Region: Smc;
                     COG1196"
                     /db_xref="CDD:224117"
     variation       715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427331221"
     variation       716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167498364"
     variation       717..718
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:774301106"
     variation       717
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460050236"
     variation       721
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395723889"
     variation       722
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565602080"
     variation       725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356542000"
     variation       728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301806462"
     variation       729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767705277"
     variation       730
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138524973"
     variation       731
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750423096"
     variation       733
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577571534"
     variation       735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753789053"
     variation       746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255782432"
     variation       747
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188633754"
     variation       750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186408181"
     variation       751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146387944"
     variation       757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470700036"
     variation       759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752351322"
     variation       763
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757986667"
     variation       766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417335046"
     variation       767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909314548"
     variation       768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777363501"
     variation       770
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375520891"
     variation       773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335368291"
     variation       775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370453746"
     variation       777
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770454650"
     variation       780
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780484058"
     variation       781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749808863"
     variation       782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2460946"
     variation       783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330739033"
     variation       783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:771875009"
     variation       785
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279198753"
     variation       786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385254547"
     variation       793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762716526"
     variation       795
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763945167"
     variation       798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751176347"
     variation       799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756879556"
     variation       807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767161895"
     variation       811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148209837"
     variation       813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755657988"
     variation       815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558723991"
     variation       817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779609657"
     variation       819
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748649753"
     variation       830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758752266"
     variation       831
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207685229"
     variation       841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778128596"
     variation       843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747208337"
     variation       846
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483211892"
     variation       848..850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:775192400"
     variation       848
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421334437"
     variation       849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771135360"
     variation       851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199533705"
     variation       852
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1036704795"
     variation       856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373516510"
     variation       860
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456640622"
     variation       861
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745986904"
     variation       864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769852533"
     variation       868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242173002"
     variation       876
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238971122"
     variation       881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765998564"
     variation       882
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542695116"
     variation       886
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424611167"
     variation       894
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469285419"
     variation       899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763398963"
     variation       907
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211565025"
     variation       908
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73954346"
     variation       910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202021546"
     variation       914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178652122"
     variation       915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553434715"
     variation       916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250962904"
     variation       919..926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggaactgg"
                     /db_xref="dbSNP:776439377"
     variation       923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757686298"
     variation       926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:894902332"
     variation       928
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374437665"
     variation       941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178718870"
     variation       944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441173043"
     variation       948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292492321"
     variation       951
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047137238"
     variation       952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750749487"
     variation       953
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202134489"
     variation       955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866210165"
     variation       957
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780376350"
     variation       959
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142334581"
     variation       960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113579201"
     variation       962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199929849"
     variation       963..971
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tcttct"
                     /replace="tcttcttct"
                     /db_xref="dbSNP:758868824"
     variation       967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216506062"
     variation       969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487321871"
     variation       970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939935158"
     variation       974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275288913"
     variation       976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755149519"
     variation       978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778787954"
     variation       991
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1431387786"
     variation       994
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558737751"
     variation       995
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200468428"
     variation       1000
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894344412"
     variation       1005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748107883"
     variation       1007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187652885"
     variation       1009
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263041888"
     variation       1010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240014258"
     variation       1013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772082347"
     variation       1018
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777741289"
     variation       1019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169837227"
     variation       1022
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746838759"
     variation       1023
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558737795"
     variation       1026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461681625"
     variation       1031
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919910894"
     variation       1034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163590196"
     variation       1036
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347643379"
     variation       1044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390294066"
     variation       1049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868736677"
     variation       1050
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1375721086"
     variation       1052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766165187"
     variation       1053
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285457452"
     variation       1055
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376738248"
     variation       1061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213677786"
     variation       1063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746930580"
     variation       1066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757141762"
     variation       1068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370827700"
     variation       1072
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368534626"
     variation       1077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769292941"
     variation       1083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372290189"
     variation       1084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748848872"
     variation       1089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768145104"
     variation       1094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141520578"
     variation       1096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159766911"
     variation       1100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761016613"
     variation       1101
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413708133"
     variation       1104
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766775912"
     variation       1106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938366734"
     variation       1108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776808644"
     variation       1111..1112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35216570"
     variation       1111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478498128"
     variation       1114
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308744812"
     variation       1115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868566268"
     variation       1120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374790581"
     variation       1130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026821005"
     variation       1132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262474465"
     variation       1134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759830991"
     variation       1142
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318255064"
     variation       1145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765415439"
     variation       1147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373554463"
     variation       1148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915570315"
     variation       1150
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284739793"
     variation       1154
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1171350569"
     variation       1160
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758608147"
     variation       1161
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1438722532"
     variation       1164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1198919570"
     variation       1167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237141922"
     variation       1169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456081578"
     variation       1173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764264510"
     variation       1174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751556782"
     variation       1175
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752749562"
     variation       1179
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558738514"
     variation       1184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912540674"
     variation       1191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377697070"
     variation       1193
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757094933"
     variation       1195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305338654"
     variation       1197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903042861"
     variation       1199
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170704241"
     variation       1201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781073297"
     variation       1208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745692153"
     variation       1209
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755917409"
     variation       1211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779742639"
     variation       1218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748938912"
     variation       1225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768163382"
     variation       1231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330573150"
     variation       1236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773788157"
     variation       1240
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747569256"
     variation       1246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340529074"
     variation       1248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218346299"
     variation       1250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769277550"
     variation       1254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771300150"
     variation       1257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759864429"
     variation       1261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201591332"
     variation       1262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775920739"
     variation       1270
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763201366"
     variation       1272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243715943"
     variation       1275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:539963771"
     variation       1278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150351597"
     variation       1282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751554456"
     variation       1283
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208830244"
     variation       1285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421189786"
     variation       1288
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264689418"
     variation       1289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761923647"
     variation       1293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767406173"
     variation       1302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390150348"
     variation       1306..1307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttacagaatcct"
                     /db_xref="dbSNP:1385104343"
     variation       1310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552450339"
     variation       1311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755932248"
     variation       1315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779761244"
     variation       1320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753498571"
     variation       1321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337362392"
     variation       1328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246568389"
     variation       1332
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265610795"
     variation       1334
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296769383"
     variation       1337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216625830"
     variation       1341
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367729142"
     variation       1342
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778423603"
     variation       1343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007980786"
     variation       1349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017594058"
     variation       1350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649752"
     variation       1353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371673633"
     variation       1356
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771587101"
     variation       1358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781607007"
     variation       1360
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746381453"
     variation       1364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758253345"
     variation       1367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043247481"
     variation       1368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775949291"
     variation       1374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763300179"
     variation       1377
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443343409"
     variation       1380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430018040"
     variation       1388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564390284"
     variation       1391
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761858711"
     variation       1392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899169070"
     variation       1394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357778821"
     variation       1401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767632667"
     variation       1403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927482380"
     variation       1408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339571489"
     variation       1412
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215840563"
     variation       1415..1421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:755348339"
     variation       1415
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:994906398"
     variation       1420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242140413"
     variation       1422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1310875966"
     variation       1423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937580013"
     variation       1433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750335313"
     variation       1434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057397524"
     variation       1436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283738431"
     variation       1438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774722092"
     variation       1440
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200754713"
     variation       1449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255214947"
     variation       1452
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766179585"
     variation       1460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375071388"
     variation       1462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753586906"
     variation       1465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149070749"
     variation       1466
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439107634"
     variation       1470
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157395042"
     variation       1476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583148"
     variation       1478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752379605"
     variation       1480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757912028"
     variation       1485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376279109"
     variation       1488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302682243"
     variation       1491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746374412"
     variation       1493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756649080"
     variation       1495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385557146"
     variation       1497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761892796"
     variation       1499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749721042"
     variation       1500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463390892"
     variation       1501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306999754"
     variation       1503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76646082"
     variation       1506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233867129"
     variation       1509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558738932"
     variation       1511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255245986"
     variation       1512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482138219"
     variation       1514
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774507288"
     variation       1518
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238954303"
     variation       1519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386969618"
     variation       1520
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748339477"
     variation       1525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1250880284"
     variation       1525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178546900"
     variation       1528..1548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gag"
                     /replace="gagataaataagttgaacgag"
                     /db_xref="dbSNP:1176920721"
     variation       1528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772062666"
     variation       1530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773289345"
     variation       1535..1537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1175935875"
     variation       1535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760633335"
     variation       1539
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766341042"
     variation       1542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452090498"
     variation       1545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776525647"
     variation       1546
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400490790"
     variation       1547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445578874"
     variation       1549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328763222"
     variation       1551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382284"
     variation       1555
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765075262"
     variation       1557
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546753702"
     variation       1558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310228623"
     variation       1560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220165389"
     variation       1561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284425608"
     variation       1563
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763543965"
     variation       1566
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376224425"
     variation       1567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756806500"
     variation       1570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186410906"
     variation       1571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385284172"
     variation       1573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558739067"
     variation       1574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755402448"
     variation       1578
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779282384"
     variation       1583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748344811"
     variation       1587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200408782"
     variation       1590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171917691"
     variation       1597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558739092"
     variation       1598..1604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:781322684"
     variation       1608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423342495"
     variation       1612
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773271826"
     variation       1614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201596826"
     variation       1615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924360145"
     variation       1617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553682391"
     variation       1618
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457914246"
     variation       1619
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770983017"
     variation       1621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776615615"
     variation       1625
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759400747"
     variation       1636
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764953975"
     variation       1646
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775306593"
     variation       1649
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217067767"
     variation       1651
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624813"
     variation       1653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763857256"
     variation       1654
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220842965"
     variation       1655
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263757051"
     variation       1656
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:934492136"
     variation       1663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051570715"
     variation       1668
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489590964"
     variation       1669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751245972"
     variation       1670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535556399"
     variation       1671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477025570"
     variation       1673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184415942"
     variation       1675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200042988"
     variation       1676
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202061636"
     variation       1678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755468422"
     variation       1691
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741176"
     variation       1692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753141947"
     variation       1694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758664500"
     variation       1695
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539887315"
     variation       1697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397845853"
     variation       1707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351554396"
     variation       1708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747229762"
     variation       1709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380239386"
     variation       1711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771005293"
     variation       1713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781192585"
     variation       1715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262588948"
     variation       1718
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141977454"
     variation       1719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218012387"
     variation       1725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769810605"
     variation       1727
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405402526"
     variation       1729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400602749"
     variation       1737
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487522778"
     variation       1738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775266412"
     variation       1739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1347129199"
     variation       1742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558193053"
     variation       1745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558739320"
     variation       1752
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729897"
     variation       1758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180903332"
     variation       1764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774149480"
     variation       1766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199925996"
     variation       1769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159186035"
     variation       1771
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767153817"
     variation       1780
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927437409"
     variation       1781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749908800"
     variation       1782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336007488"
     variation       1786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760076821"
     variation       1787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1297778289"
     variation       1790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765826004"
     variation       1793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057519387"
     variation       1794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753133550"
     variation       1798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758866357"
     variation       1799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481644642"
     variation       1813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1421904421"
     variation       1816
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993461340"
     variation       1817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778047476"
     variation       1826
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751794952"
     variation       1829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757422255"
     variation       1830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781280877"
     variation       1833
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746008880"
     variation       1835
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769748065"
     variation       1836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240810622"
     variation       1837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193332313"
     variation       1838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534102235"
     variation       1839
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749110429"
     variation       1840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768508067"
     variation       1844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774235989"
     variation       1849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761585182"
     variation       1851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198814494"
     variation       1862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574072336"
     variation       1869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048297594"
     variation       1876
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316857514"
     variation       1887
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771895994"
     variation       1890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772980641"
     variation       1893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225559696"
     variation       1900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447793659"
     variation       1902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949032983"
     variation       1903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375856134"
     variation       1904..1911
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1558739486"
     variation       1905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765805903"
     variation       1914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369977320"
     variation       1916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374737591"
     variation       1925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753254448"
     variation       1926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1326973625"
     variation       1930..1937
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaattaaa"
                     /db_xref="dbSNP:752944414"
     variation       1933
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281990243"
     variation       1940
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374813941"
     variation       1944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448662773"
     variation       1949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344757214"
     variation       1950
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393854068"
     variation       1955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404677344"
     variation       1956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764466155"
     variation       1958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260381807"
     variation       1968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751881094"
     variation       1973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198848160"
     variation       1974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237083074"
     variation       1978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369170580"
     variation       1982
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200948483"
     variation       1985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767784682"
     variation       1988
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746003"
     variation       1992
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167702345"
     variation       1993..1997
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1477651601"
     variation       1993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197102034"
     variation       1994
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048154580"
     variation       1999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555252199"
     variation       2003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466384395"
     variation       2007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773384748"
     variation       2011..2013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1394461749"
     variation       2011
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1444139642"
     variation       2012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779938219"
     variation       2013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004130499"
     variation       2016
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035232214"
     variation       2019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749267870"
     variation       2020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006736114"
     variation       2024
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1331092618"
     variation       2025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754922343"
     variation       2027..2031
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:756135294"
     variation       2032..2037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atatca"
                     /db_xref="dbSNP:1341495036"
     variation       2033
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959784795"
     variation       2034..2037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atca"
                     /db_xref="dbSNP:1218883900"
     variation       2035
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778958751"
     variation       2042
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1157197068"
     variation       2045
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257604297"
     variation       2046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1336881383"
     variation       2048
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022524104"
     variation       2049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968390662"
     variation       2051
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211043257"
     variation       2055
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748009845"
     variation       2057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760868283"
     variation       2058
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978383532"
     variation       2067..2079
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaaaaa"
                     /replace="agaaaaagaaaaa"
                     /db_xref="dbSNP:777760783"
     variation       2071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771983890"
     variation       2073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478004008"
     variation       2074
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193224912"
     variation       2078
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1553438402"
     variation       2079..2089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="attaa"
                     /replace="attaacattaa"
                     /db_xref="dbSNP:745790902"
     variation       2079
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147654490"
     variation       2082
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772987604"
     variation       2084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746578708"
     variation       2090
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1423349948"
     variation       2093
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142684498"
     variation       2100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775957002"
     variation       2102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140818127"
     variation       2103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943194201"
     variation       2105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038941538"
     variation       2106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920490239"
     variation       2107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930649631"
     variation       2110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190820622"
     variation       2112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146700196"
     variation       2113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246499911"
     variation       2119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047693033"
     variation       2120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762231999"
     variation       2122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145247044"
     variation       2124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978819011"
     variation       2133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377604308"
     variation       2136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149652536"
     variation       2138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185517792"
     variation       2140..2146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagcaag"
                     /db_xref="dbSNP:1488502523"
     variation       2140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215702024"
     variation       2144..2149
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:771974664"
     variation       2149
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766508161"
     variation       2150
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372937652"
     variation       2152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753899949"
     variation       2154
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237970379"
     variation       2159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556272156"
     variation       2163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442812086"
     variation       2167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274881421"
     variation       2169..2171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:779888794"
     variation       2172
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381407477"
     variation       2173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419608695"
     variation       2174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779054955"
     variation       2175
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748096672"
     variation       2178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758275416"
     variation       2179..2183
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:1558739859"
     variation       2180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777375176"
     variation       2181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334360314"
     variation       2182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746698287"
     variation       2183
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770450276"
     variation       2184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776316287"
     variation       2185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745440605"
     variation       2195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183575645"
     variation       2197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373973137"
     variation       2204
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774841781"
     variation       2206
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762248388"
     variation       2209
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767889211"
     variation       2211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773406502"
     variation       2224
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460045507"
     variation       2226..2233
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagtcaag"
                     /db_xref="dbSNP:746744919"
     variation       2226..2227
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1442513029"
     variation       2230..2231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:768578200"
     variation       2232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439677984"
     variation       2236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761066885"
     variation       2238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200958316"
     variation       2239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754082179"
     variation       2244..2249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:776384329"
     variation       2245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200270126"
     variation       2246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765343878"
     variation       2248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205671661"
     variation       2249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332839102"
     variation       2253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752697494"
     variation       2255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758365184"
     variation       2256
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304732223"
     variation       2261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257044582"
     variation       2267
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148359301"
     variation       2268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031375413"
     variation       2272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751351993"
     variation       2274
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111527126"
     variation       2277
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370488160"
     variation       2280..2286
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcag"
                     /replace="gcagcag"
                     /db_xref="dbSNP:1200741086"
     variation       2280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528729535"
     variation       2282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745455759"
     variation       2291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480328029"
     variation       2293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995115"
     variation       2295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769306376"
     variation       2298
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434246089"
     variation       2306
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490121597"
     variation       2307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748202873"
     variation       2311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940939996"
     variation       2314
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427602721"
     variation       2315..2356
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atg"
                     /replace="atgcccttctcgaaactgtgaatcgcctccagggagaaaatg"
                     /db_xref="dbSNP:1315005166"
     variation       2315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111613095"
     variation       2319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467952366"
     variation       2320..2324
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1558740067"
     variation       2325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540949615"
     variation       2326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562126455"
     variation       2330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772493105"
     variation       2332
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352409978"
     variation       2335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176292274"
     variation       2338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377282558"
     variation       2339
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761006452"
     variation       2345
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771325509"
     variation       2347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346503661"
     variation       2349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305544670"
     variation       2354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282438487"
     variation       2357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776999762"
     variation       2358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759778171"
     variation       2359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279003695"
     variation       2361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467723931"
     variation       2364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765431163"
     variation       2367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202595118"
     variation       2374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752787189"
     variation       2375
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489117399"
     variation       2383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763095072"
     variation       2385..2386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1423397180"
     variation       2386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763988821"
     variation       2387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175972132"
     variation       2389
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751509052"
     variation       2399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195400958"
     variation       2404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371790236"
     variation       2405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427539820"
     variation       2407
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167781340"
     variation       2416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780981207"
     variation       2418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501385"
     variation       2420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302431416"
     variation       2424
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363495038"
     variation       2428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755720124"
     variation       2429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779646741"
     variation       2431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369626877"
     variation       2432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361609748"
     variation       2443..2452
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agtc"
                     /replace="agtctcagtc"
                     /db_xref="dbSNP:761581032"
     variation       2444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768195223"
     variation       2445
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778213807"
     variation       2446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019082050"
     variation       2447
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245928069"
     variation       2458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290135176"
     variation       2459
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489482701"
     variation       2460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747487244"
     variation       2461
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771216512"
     variation       2462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222504208"
     variation       2463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485361240"
     variation       2465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1323747305"
     variation       2466
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184380647"
     variation       2467
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373780548"
     variation       2469
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:964534174"
     variation       2472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759869953"
     variation       2473
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162868458"
     variation       2484..2486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:756971621"
     variation       2487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402462037"
     variation       2490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383371246"
     variation       2491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770183232"
     variation       2493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298626440"
     variation       2495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920522699"
     variation       2496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428913746"
     variation       2501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733788"
     variation       2503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550791699"
     variation       2505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470443354"
     variation       2506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010141859"
     variation       2513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377725944"
     variation       2517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356545280"
     variation       2521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774169009"
     variation       2525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200008152"
     variation       2527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284064502"
     variation       2540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767246456"
     variation       2542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750255811"
     variation       2543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426501841"
     variation       2544
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773730114"
     variation       2545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371376562"
     variation       2552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143706341"
     variation       2564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747355682"
     variation       2567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753488471"
     variation       2571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754454908"
     variation       2572
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778431070"
     variation       2573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939317682"
     variation       2581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282502541"
     variation       2583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139691316"
     variation       2585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753625999"
     variation       2587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757744857"
     variation       2589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178521867"
     variation       2590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398374320"
     variation       2591
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407187260"
     variation       2593
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895191613"
     variation       2596
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781756304"
     variation       2600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948209315"
     variation       2603..2604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:769325355"
     variation       2609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373924982"
     variation       2613..2617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agtag"
                     /db_xref="dbSNP:1379176443"
     variation       2615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448191708"
     variation       2617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145077426"
     variation       2621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274371671"
     variation       2624..2628
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="caatc"
                     /db_xref="dbSNP:1216852012"
     variation       2624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770271101"
     variation       2626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221355978"
     variation       2634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741717"
     variation       2638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749469344"
     variation       2639
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024464817"
     variation       2641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260734243"
     variation       2644
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191279740"
     variation       2649
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761764768"
     variation       2652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329552835"
     variation       2655
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031657685"
     variation       2657
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460307482"
     variation       2667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483560293"
     variation       2668
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61739749"
     variation       2670..2676
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agga"
                     /replace="aggagga"
                     /db_xref="dbSNP:772664758"
     variation       2672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891475133"
     variation       2674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740583"
     variation       2675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767490206"
     variation       2677
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773116841"
     variation       2681
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367881891"
     variation       2682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411624165"
     variation       2686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920857758"
     variation       2689..2692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttaa"
                     /db_xref="dbSNP:1402557746"
     variation       2690..2694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="taaaa"
                     /db_xref="dbSNP:763502591"
     variation       2690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182461304"
     variation       2691..2700
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaag"
                     /replace="aaaagaaaag"
                     /db_xref="dbSNP:766736753"
     variation       2696
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353341747"
     variation       2701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439184703"
     variation       2704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140310167"
     variation       2705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345221071"
     variation       2706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766099385"
     variation       2708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555677090"
     variation       2711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740656"
     variation       2715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576244953"
     variation       2719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764688075"
     variation       2725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752293612"
     variation       2728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436046060"
     variation       2731
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757826462"
     variation       2732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182645789"
     variation       2733
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372074612"
     variation       2734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150938411"
     variation       2745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749502433"
     variation       2746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475864400"
     variation       2747
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150078317"
     variation       2748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394396750"
     variation       2749
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376990612"
     variation       2753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304241885"
     variation       2759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772129982"
     variation       2761..2766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:759852289"
     variation       2761..2763
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:752109794"
     variation       2761
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226547497"
     variation       2766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403426657"
     variation       2767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773135239"
     variation       2769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141805666"
     variation       2770
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391057767"
     variation       2780..2781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:767887598"
     variation       2780
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1269123750"
     variation       2781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369088854"
     variation       2786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298541997"
     variation       2787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372865093"
     variation       2789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200389027"
     variation       2793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577283127"
     variation       2794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375946212"
     variation       2795
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759222318"
     variation       2804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61741893"
     variation       2806..2810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:752891062"
     variation       2807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764991505"
     variation       2814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762619155"
     variation       2819
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945879082"
     variation       2822..2829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:756364486"
     variation       2822
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763638702"
     variation       2826
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406749496"
     variation       2830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750989248"
     variation       2837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371440005"
     variation       2842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1473780638"
     variation       2850..2851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1164785165"
     variation       2851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558740890"
     variation       2852..2858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:777909420"
     variation       2856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776466243"
     variation       2858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780392284"
     variation       2864..2868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1160864211"
     variation       2864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754274589"
     variation       2865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186457569"
     variation       2867..2873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:553103180"
     variation       2871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779257690"
     variation       2872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748248613"
     variation       2875
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772156346"
     variation       2876
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358697601"
     variation       2881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777785198"
     variation       2884..2889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:757374682"
     variation       2887
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259075581"
     variation       2891
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368592749"
     variation       2893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770899061"
     variation       2894
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372319248"
     variation       2901
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776412280"
     variation       2905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759260339"
     variation       2908..2912
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:779791241"
     variation       2910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444328870"
     variation       2915..2916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1230076424"
     variation       2922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290111450"
     variation       2934
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759436302"
     variation       2935
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242578153"
     variation       2937
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769472880"
     variation       2940..2944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="taatt"
                     /db_xref="dbSNP:746975961"
     variation       2942
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364766321"
     variation       2956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553327544"
     variation       2963
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762645439"
     variation       2965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405508254"
     variation       2968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992533570"
     variation       2969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741028"
     variation       2971
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763728337"
     variation       2980..2984
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttatt"
                     /db_xref="dbSNP:1392708707"
     variation       2983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138472765"
     variation       2984
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761384692"
     variation       2985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916577022"
     variation       2989
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364082251"
     variation       2991
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381340267"
     variation       2997
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766964266"
     variation       3002
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750341029"
     variation       3004
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336144112"
     variation       3010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1238134261"
     variation       3011..3012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1258733483"
     variation       3013..3019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaagaaa"
                     /db_xref="dbSNP:1055792867"
     variation       3019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325973107"
     variation       3021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755370564"
     variation       3025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260191310"
     variation       3026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779086346"
     variation       3027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752942121"
     variation       3035
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181053232"
     variation       3039
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251796166"
     variation       3042..3043
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="caa"
                     /db_xref="dbSNP:1419002672"
     variation       3043..3044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1382806587"
     variation       3049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758583225"
     variation       3050
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379714687"
     variation       3053
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757883913"
     variation       3054
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741151"
     variation       3057..3063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /db_xref="dbSNP:768523280"
     variation       3057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948157020"
     variation       3059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223836489"
     variation       3064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764900269"
     variation       3067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376201616"
     variation       3069
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293344874"
     variation       3070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467722939"
     variation       3075
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014322616"
     variation       3076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781259774"
     variation       3081
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368499106"
     variation       3082
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540561575"
     variation       3088
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347103200"
     variation       3089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558741197"
     variation       3093..3094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1224383207"
     variation       3094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147267352"
     variation       3101
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749060582"
     variation       3105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1321520535"
     variation       3108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768472292"
     variation       3116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62000420"
     variation       3120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962155514"
     variation       3124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761471420"
     variation       3133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766868631"
     variation       3134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777206295"
     variation       3137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373358076"
     variation       3138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480930422"
     variation       3141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199715610"
     variation       3145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765668476"
     variation       3148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377548265"
     variation       3150
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558741259"
     variation       3151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293995034"
     variation       3152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263972654"
     variation       3155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774873391"
     variation       3158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181789592"
     variation       3164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479248738"
     variation       3169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202022886"
     variation       3171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964071112"
     variation       3173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461440891"
     variation       3175..3178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1296335720"
     variation       3180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380536974"
     variation       3185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758744395"
     variation       3187
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374201747"
     variation       3190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751776542"
     variation       3193
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302288457"
     variation       3195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757364490"
     variation       3196
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052721221"
     variation       3198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781076781"
     variation       3202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296418496"
     variation       3208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1366183315"
     variation       3208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745847876"
     variation       3211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306956276"
     variation       3213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147227525"
     variation       3214..3218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1558741343"
     variation       3217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780117635"
     variation       3220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294514823"
     variation       3222
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490652955"
     variation       3229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222296847"
     variation       3230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749153398"
     variation       3231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367728508"
     variation       3233
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741376"
     variation       3240
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370623394"
     variation       3244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747741971"
     variation       3245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771631848"
     variation       3246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168245988"
     variation       3249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336979954"
     variation       3253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387071496"
     variation       3254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361987402"
     variation       3255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1040053435"
     variation       3256
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560484"
     variation       3259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760204378"
     variation       3260..3265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agttag"
                     /db_xref="dbSNP:781183137"
     variation       3262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162752039"
     variation       3264
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563097138"
     variation       3269
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201325666"
     variation       3273..3275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:925811579"
     variation       3274
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775964196"
     variation       3275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139623765"
     variation       3281
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146256742"
     variation       3282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751795034"
     variation       3287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757380227"
     variation       3289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392507603"
     variation       3290
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144062162"
     variation       3291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894451722"
     variation       3292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444078397"
     variation       3293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951929244"
     variation       3296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319064296"
     variation       3300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527733249"
     variation       3301
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014683399"
     variation       3303..3308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tct"
                     /replace="tcttct"
                     /db_xref="dbSNP:747772330"
     variation       3304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005083150"
     variation       3310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485331180"
     variation       3313
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536516536"
     variation       3314
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186194933"
     variation       3315..3320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaa"
                     /replace="gaagaa"
                     /db_xref="dbSNP:1202843350"
     variation       3317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244424916"
     variation       3319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567813236"
     variation       3320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149051213"
     variation       3321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749167273"
     variation       3323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243229382"
     variation       3333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200328829"
     variation       3335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014849447"
     variation       3336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778799262"
     variation       3337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747868838"
     variation       3338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451858435"
     variation       3344
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771664379"
     variation       3347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777463225"
     variation       3351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452583533"
     variation       3353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313471572"
     variation       3355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992073362"
     variation       3356..3359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1558741601"
     variation       3357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376001079"
     variation       3359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373019080"
     variation       3367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224741919"
     variation       3370..3376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:769389279"
     variation       3373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746562390"
     variation       3375..3378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="agta"
                     /db_xref="dbSNP:772930314"
     variation       3378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424149870"
     variation       3380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385964891"
     variation       3382
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775980873"
     variation       3384
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763395652"
     variation       3387..3388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1182556330"
     variation       3387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993580082"
     variation       3396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235725178"
     variation       3401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027769388"
     variation       3405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769032581"
     variation       3407
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916608229"
     variation       3408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406948239"
     variation       3412..3423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaaaaa"
                     /replace="gaaaaagaaaaa"
                     /db_xref="dbSNP:1471744452"
     variation       3414
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178798839"
     variation       3418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774737186"
     variation       3424
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762213492"
     variation       3438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374523392"
     variation       3443
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1490152565"
     variation       3447
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750652114"
     variation       3448
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151131536"
     variation       3450
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766504781"
     variation       3453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567509759"
     variation       3458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147113988"
     variation       3463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284743129"
     variation       3468
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322611947"
     variation       3473
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778966752"
     variation       3478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222443730"
     variation       3479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751461574"
     variation       3484..3488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1439543677"
     variation       3488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205071225"
     variation       3490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902683816"
     variation       3491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481909936"
     variation       3492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371074235"
     variation       3498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:925335557"
     variation       3499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777356661"
     variation       3500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746606214"
     variation       3501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029375087"
     variation       3504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142522262"
     variation       3505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780634068"
     variation       3506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366658848"
     variation       3511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748627738"
     variation       3514
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769572125"
     variation       3515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772341027"
     variation       3517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138827624"
     variation       3518
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771330093"
     variation       3519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933489795"
     variation       3520
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362992732"
     variation       3521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775165071"
     variation       3527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248048275"
     variation       3532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182216335"
     variation       3533
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144683999"
     variation       3534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1292269123"
     variation       3538
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188078487"
     variation       3541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776983164"
     variation       3543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759759979"
     variation       3548..3551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1208301358"
     variation       3552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286683427"
     variation       3554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249613038"
     variation       3556
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765298197"
     variation       3558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558742437"
     variation       3560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965465988"
     variation       3561..3564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1417198054"
     variation       3561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304894"
     variation       3567..3571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gttgg"
                     /db_xref="dbSNP:1246244416"
     variation       3568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042628793"
     variation       3572..3573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1447003740"
     variation       3574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184707117"
     variation       3582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762900631"
     variation       3590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868067864"
     variation       3593
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181112325"
     variation       3604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212264385"
     variation       3609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412092118"
     variation       3611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542133511"
     variation       3613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468338283"
     variation       3620..3627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:1274157961"
     variation       3620
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289466323"
     variation       3626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565086656"
     variation       3636
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933668519"
     variation       3642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327634074"
     variation       3652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748607399"
     variation       3655..3659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agtag"
                     /replace="agtagtag"
                     /db_xref="dbSNP:963039751"
     variation       3659..3660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1345444872"
     variation       3660..3661
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1222373161"
     variation       3660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050745412"
     variation       3663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275968998"
     variation       3669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758830254"
     variation       3670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185445145"
     variation       3680
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326281192"
     variation       3690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1385823855"
     variation       3693
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313564018"
     variation       3697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747681763"
     variation       3698
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778349044"
     variation       3700
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558743813"
     variation       3707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157553403"
     variation       3709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470186484"
     variation       3710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942481469"
     variation       3711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575549000"
     variation       3713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1038090097"
     variation       3715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453377807"
     variation       3717..3719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1244554301"
     variation       3720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911706324"
     variation       3723..3724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:557294565"
     variation       3726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176462444"
     variation       3728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445811197"
     variation       3729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988044487"
     variation       3736
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558743865"
     variation       3745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915146127"
     variation       3746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230406567"
     variation       3748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898326901"
     variation       3750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430759869"
     variation       3751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993992993"
     variation       3752
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455223886"
     variation       3767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200725205"
     variation       3771
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045465787"
     variation       3773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385653389"
     variation       3792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545909467"
     variation       3796..3797
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1401148810"
     variation       3801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386536334"
     variation       3804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907148478"
     variation       3817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:939418775"
     variation       3818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:6719131"
     variation       3834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189908319"
     variation       3836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958725637"
     variation       3843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194561422"
     variation       3844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:990646339"
     variation       3846
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449190892"
     variation       3853
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887248179"
     variation       3857..3858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1210215231"
     variation       3857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1404590898"
     variation       3860..3864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1348953894"
     variation       3862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284215660"
     variation       3865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021671787"
     variation       3872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967966936"
     variation       3876
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536473761"
     variation       3885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004794421"
     variation       3890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546763127"
     variation       3892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1207222052"
     variation       3894
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053027"
     variation       3899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997140701"
     variation       3900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561744980"
     variation       3916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776795824"
     variation       3917
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1419279894"
     variation       3919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168832102"
     variation       3929
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476698016"
     variation       3931
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256020899"
     variation       3939
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029058874"
     variation       3943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1199654539"
     variation       3943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270679512"
     variation       3944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933616113"
     variation       3946
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530314496"
     variation       3948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910897059"
     variation       3959
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307085063"
     variation       3961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942343180"
     variation       3966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1038547780"
     variation       3969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214907014"
     variation       3971
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018716014"
     variation       3972
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291341872"
     variation       3974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455308271"
     variation       3976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956487794"
     variation       3977
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314131039"
     variation       3984..3985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1439636060"
     variation       3992
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988377244"
     variation       3995
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330051989"
     variation       3999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411988745"
     variation       4004
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915114451"
     variation       4006
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164840274"
     variation       4011
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898217470"
     variation       4013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425143243"
     variation       4020..4031
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcat"
                     /replace="gcatacctgcat"
                     /db_xref="dbSNP:771208415"
     variation       4020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146606449"
     variation       4026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1480450907"
     variation       4027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1232725159"
     variation       4043
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1046955143"
     variation       4047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:980736115"
     variation       4049..4056
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaaagaa"
                     /db_xref="dbSNP:1347640538"
     variation       4050
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408001757"
     variation       4066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907032389"
     variation       4067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926601445"
     variation       4070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458933222"
     variation       4085..4088
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1306428244"
     variation       4086
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538617845"
     variation       4093
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002825122"
     variation       4094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335371656"
     variation       4098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034233333"
     variation       4100..4105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1221571690"
     variation       4108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139018047"
     variation       4110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011551240"
     variation       4123
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223762700"
     variation       4132..4133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1392778755"
     variation       4133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325591425"
     variation       4139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293421116"
     variation       4148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:764183320"
     variation       4148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17036399"
     variation       4149..4156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttgt"
                     /replace="ttgtttgt"
                     /db_xref="dbSNP:940157392"
     variation       4155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2577618"
     variation       4159..4162
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:1250637776"
     variation       4162..4166
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="ataat"
                     /db_xref="dbSNP:1179208148"
     variation       4165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116841577"
     variation       4172
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:17036402"
     variation       4178..4180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cac"
                     /db_xref="dbSNP:1185328190"
     variation       4190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212808376"
ORIGIN      
ccttcgggaaagggtggcctcgggccccctactctacagagtctcctcccacggctgcccagttccctggccgactatcttgcctccaccacatcaccatcagtaccgggcggctgcagggcagagctgtccagggacctcctcacagcctccagagtcaagaaatgcctcctcagggaagccctctaccgcatccctgacctgtgagtcacggagctcccgggcaccatgctggccacaaatgcctaaggagccccccggaaccagctgtgggtcccgcaggcactcgcaggctagcggacacctttggaggactgagagacctgtcctgcaatccaatgttcctcactctcacaagattttacagacgtggaaaccgaggcccgaggccccaaggggtaatcggcccgccttcccatgccaataaccggcagtggcgggacccacacctactccgtgacctgcaggcccaggggtcgagccccaggtagaacgtctagacggactccgcccttagcgccgtacggggaaccttctcccggacgcagacacggaagcggaagtgctgccgagctgtagctatggagacgtggggggcgggccgcccggagagcgcgacctttgacctgcagtagagcctacgtcagaggctggcgcaaacagaagtgcagcggtggcggcggctggttgcgggccggcggcgggctggcggagatggaggtaactcaggatcttgttcaagatggggtggcttcaccagctacccctgggaccgggaaatctaagctggaaacattgcccaaagaagacctcatcaagtttgccaagaaacagatgatgctaatacagaaagctaaatcaaggtgtacagaattggagaaagaaattgaagaactcagatcaaaacctgttactgaaggaactggtgatattattaaggcattaactgaacgtctggatgctcttcttctggaaaaagcagagactgagcaacagtgtctttctctgaaaaaggaaaatataaaaatgaagcaagaggttgaggattctgtaacaaagatgggagatgcacataaggagttggaacaatcacatataaactatgtgaaagaaattgaaaatttgaaaaatgagttgatggcagtacgttccaaatacagtgaagacaaagctaacttacaaaagcagctggaagaagcaatgaatacgcaattagaactttcagaacaacttaaatttcagaacaactctgaagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttgaggagcaaattttatatctgcaaaagcaattagacgctaccactgatgaaaagaaggaaacagttactcaactccaaaatatcattgaggctaattctcagcattaccaaaaaaatattaatagtttgcaggaagagcttttacagttgaaagctatacaccaagaagaggtgaaagagttgatgtgccagattgaagcatcagctaaggaacatgaagcagagataaataagttgaacgagctaaaagagaacttagtaaaacaatgtgaggcaagtgaaaagaacatccagaagaaatatgaatgtgagttagaaaatttaaggaaagccacctcaaatgcaaaccaagacaatcagatatgttctattctcttgcaagaaaatacatttgtagaacaagtagtaaatgaaaaagtcaaacacttagaagataccttaaaagaacttgaatctcaacacagtatcttaaaagatgaggtaacttatatgaataatcttaagttaaaacttgaaatggatgctcaacatataaaggatgagttttttcatgaacgggaagacttagagtttaaaattaatgaattattactagctaaagaagaacagggctgtgtaattgaaaaattaaaatctgagctagcaggtttaaataaacagttttgctatactgtagaacagcataacagagaagtacagagtcttaaggaacaacatcaaaaagaaatatcagaactaaatgagacatttttgtcagattcagaaaaagaaaaattaacattaatgtttgaaatacagggtcttaaggaacagtgtgaaaacctacagcaagaaaagcaagaagcaattttaaattatgagagtttacgagagattatggaaattttacaaacagaactgggggaatctgctggaaaaataagtcaagagttcgaatcaatgaagcaacagcaagcatctgatgttcatgaactgcagcagaagctcagaactgcttttactgaaaaagatgcccttctcgaaactgtgaatcgcctccagggagaaaatgaaaagttactatctcaacaagaattggtaccagaacttgaaaataccataaagaaccttcaagaaaagaatggagtatacttacttagtctcagtcaaagagataccatgttaaaagaattagaaggaaagataaattctcttactgaggaaaaagatgattttataaataaactgaaaaattcccatgaagaaatggataatttccataagaaatgtgaaagggaagaaagattgattcttgaacttgggaagaaagtagagcaaacaatccagtacaacagtgaactagaacaaaaggtaaatgaattaacaggaggactagaggagactttaaaagaaaaggatcaaaatgaccaaaaactagaaaaacttatggttcaaatgaaagttctctctgaagacaaagaagtattgtcagctgaagtgaagtctctttatgaggaaaacaataaactcagttcagaaaaaaaacagttgagtagggatttggaggtttttttgtctcaaaaagaagatgttatccttaaagaacatattactcaattagaaaagaaacttcagttaatggttgaagagcaagataatttaaataaactgcttgaaaatgagcaagttcagaagttatttgttaaaactcagttgtatggttttcttaaagaaatgggatcagaagtttcagaagacagtgaagagaaagatgttgttaatgtcctacaggcagtcggtgaatccttggcaaaaataaatgaggaaaaatgcaacctggcttttcagcgtgatgaaaaagtattagagttagaaaaagagattaagtgccttcaagaagagagtgtagttcagtgtgaagaacttaagtctttattgagagactatgagcaagagaaagttctcttaaggaaagagttagaagaaatacagtcagaaaaagaggccctgcagtctgatcttctagaaatgaagaatgctaatgaaaaaacaaggcttgaaaatcagaatcttttaattcaagttgaagaagtatctcaaacatgtagcaaaagtgaaatccataatgaaaaagaaaaatgttttataaaggaacatgaaaacctaaagccactactagaacaaaaagaattacgagataggagagcagagttgatactattaaaggattccttagcaaaatcaccttctgtaaaaaatgatcctctgtcttcagtaaaagagttggaagaaaaaataggaaaaaatcgactagaaaggggaaaattattgctgcagaagaaggagggagaattgttgctctgatgcttgagtaggtaatgagacgcaggatgaaatgcagatgtggaacaattggcctttgctccgcacacagacacttcactatggcagccagagggaaggcaccggtgcaagtaaattaataggccaggacagaaattcagatcataactgaatttttagaaacaaataccaagaagtcctgaactcaggagttcaagctaaagaagttaacagagatcaatattggataggtaaaacatattacaggtttcgttgtgaaaatcagacccagcagccaagaggaggagtgcacttatggagcataaatgttgatctgcatctgatatctctgatacttgatcctaatttgcacactatcacctaaagtcctagcatacctgcatttccaggaaatctaatgagaaagaagtcctgaaagcctctaattcctggaaacatatgaaacggctagaaaaaagtagactattttggaggattaaagacaatggaaactttttacattgtttgtctcacataatgaataaaattccactttaaaaaatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]