GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:12:15, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_006712871            6800 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens GRIP and coiled-coil domain containing 2
            (GCC2), transcript variant X2, mRNA.
ACCESSION   XM_006712871
VERSION     XM_006712871.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000002.12) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6800
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
     gene            1..6800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="GRIP and coiled-coil domain containing 2; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 mRNA, 164 ESTs, 397 long SRA reads, 3 Proteins, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments, including 68 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
     variation       1
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574492010"
     variation       2
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474016978"
     variation       3
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200624188"
     variation       6
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1255127111"
     variation       6
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454919416"
     variation       8
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747693822"
     variation       9..14
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agcggt"
                     /replace="agcggtagcggt"
                     /db_xref="dbSNP:1162852987"
     variation       9
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393404342"
     variation       10
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771544904"
     variation       11
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032200284"
     variation       13
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541919188"
     variation       14
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1473625015"
     variation       14
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764691463"
     variation       15..43
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ggcggcgg"
                     /replace="ggcggcggctggttgcgggccggcggcgg"
                     /db_xref="dbSNP:769865848"
     variation       15
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460800506"
     variation       16
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558721939"
     variation       17..41
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="cggcggctggttgcgggccggcggc"
                     /replace="cggcggctggttgcgggccggcggctggttgcgggccggcggc"
                     /db_xref="dbSNP:1374347716"
     variation       18
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759956198"
     variation       18
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gccag"
                     /db_xref="dbSNP:1558721960"
     variation       21
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014717464"
     variation       25..43
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggttgcgggccggcggcgg"
                     /db_xref="dbSNP:1441240714"
     variation       25
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765637800"
     variation       26
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230400164"
     variation       27
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887917053"
     variation       28..38
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgcgggccggc"
                     /db_xref="dbSNP:1348902900"
     variation       29..45
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcgggccggcggcgggc"
                     /replace="gcgggccggcggcgggccggcggcgggc"
                     /db_xref="dbSNP:1368187862"
     variation       30
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370365824"
     variation       31
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575208339"
     variation       34
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306778516"
     variation       35
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920494835"
     variation       36..51
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ggcgg"
                     /replace="ggcggcgggctggcgg"
                     /replace="ggcggcgggctggcggcgggctggcgg"
                     /db_xref="dbSNP:776397797"
     variation       36
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896734136"
     variation       38
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274881264"
     variation       39
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013954399"
     variation       40
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213350683"
     variation       41
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1023965750"
     variation       43
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477374361"
     variation       44
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544110704"
     variation       45
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246928493"
     variation       50
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751810629"
     variation       53
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757471595"
     variation       54
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427331221"
     variation       55
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167498364"
     variation       56..57
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:774301106"
     variation       56
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460050236"
     variation       60
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395723889"
     variation       61
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565602080"
     variation       64
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356542000"
     variation       67
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301806462"
     variation       68
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767705277"
     variation       69
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138524973"
     variation       70
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750423096"
     variation       72
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577571534"
     variation       74
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753789053"
     variation       85
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255782432"
     variation       86
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188633754"
     variation       89
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186408181"
     variation       90
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146387944"
     variation       96
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470700036"
     variation       98
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752351322"
     variation       102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757986667"
     variation       105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417335046"
     variation       106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909314548"
     variation       107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777363501"
     variation       109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375520891"
     variation       112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335368291"
     variation       114
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370453746"
     variation       116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770454650"
     variation       119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780484058"
     variation       120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749808863"
     variation       121
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2460946"
     variation       122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330739033"
     variation       122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:771875009"
     variation       124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279198753"
     variation       125
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385254547"
     variation       130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238971122"
     variation       135
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765998564"
     variation       136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542695116"
     variation       140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424611167"
     variation       148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469285419"
     variation       153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763398963"
     variation       161
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211565025"
     variation       162
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73954346"
     variation       164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202021546"
     variation       168
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178652122"
     variation       169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553434715"
     variation       170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250962904"
     variation       173..180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggaactgg"
                     /db_xref="dbSNP:776439377"
     variation       177
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757686298"
     variation       180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:894902332"
     variation       182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374437665"
     variation       195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178718870"
     variation       198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441173043"
     variation       202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292492321"
     variation       205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047137238"
     variation       206
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750749487"
     variation       207
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202134489"
     variation       209
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866210165"
     variation       211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780376350"
     variation       213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142334581"
     variation       214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113579201"
     variation       216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199929849"
     variation       217..225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tcttct"
                     /replace="tcttcttct"
                     /db_xref="dbSNP:758868824"
     variation       221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216506062"
     variation       223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487321871"
     variation       224
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939935158"
     variation       228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275288913"
     variation       230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755149519"
     variation       232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778787954"
     variation       245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1431387786"
     variation       248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558737751"
     variation       249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200468428"
     variation       254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894344412"
     variation       259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748107883"
     variation       261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187652885"
     variation       263
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263041888"
     variation       264
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240014258"
     variation       267
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772082347"
     variation       272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777741289"
     variation       273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169837227"
     variation       276
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746838759"
     variation       277
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558737795"
     variation       280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461681625"
     CDS             281..5032
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /codon_start=1
                     /product="GRIP and coiled-coil domain-containing protein 2
                     isoform X2"
                     /protein_id="XP_006712934.1"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
                     /translation="
MKQEVEDSVTKMGDAHKELEQSHINYVKEIENLKNELMAVRSKYSEDKANLQKQLEEAMNTQLELSEQLKFQNNSEDNVKKLQEEIEKIRPGFEEQILYLQKQLDATTDEKKETVTQLQNIIEANSQHYQKNINSLQEELLQLKAIHQEEVKELMCQIEASAKEHEAEINKLNELKENLVKQCEASEKNIQKKYECELENLRKATSNANQDNQICSILLQENTFVEQVVNEKVKHLEDTLKELESQHSILKDEVTYMNNLKLKLEMDAQHIKDEFFHEREDLEFKINELLLAKEEQGCVIEKLKSELAGLNKQFCYTVEQHNREVQSLKEQHQKEISELNETFLSDSEKEKLTLMFEIQGLKEQCENLQQEKQEAILNYESLREIMEILQTELGESAGKISQEFESMKQQQASDVHELQQKLRTAFTEKDALLETVNRLQGENEKLLSQQELVPELENTIKNLQEKNGVYLLSLSQRDTMLKELEGKINSLTEEKDDFINKLKNSHEEMDNFHKKCEREERLILELGKKVEQTIQYNSELEQKVNELTGGLEETLKEKDQNDQKLEKLMVQMKVLSEDKEVLSAEVKSLYEENNKLSSEKKQLSRDLEVFLSQKEDVILKEHITQLEKKLQLMVEEQDNLNKLLENEQVQKLFVKTQLYGFLKEMGSEVSEDSEEKDVVNVLQAVGESLAKINEEKCNLAFQRDEKVLELEKEIKCLQEESVVQCEELKSLLRDYEQEKVLLRKELEEIQSEKEALQSDLLEMKNANEKTRLENQNLLIQVEEVSQTCSKSEIHNEKEKCFIKEHENLKPLLEQKELRDRRAELILLKDSLAKSPSVKNDPLSSVKELEEKIENLEKECKEKEEKINKIKLVAVKAKKELDSSRKETQTVKEELESLRSEKDQLSASMRDLIQGAESYKNLLLEYEKQSEQLDVEKERANNFEHRIEDLTRQLRNSTLQCETINSDNEDLLARIETLQSNAKLLEVQILEVQRAKAMVDKELEAEKLQKEQKIKEHATTVNELEELQVQLQKQKKQLQKTMQELELVKKDAQQTTLMNMEIADYERLMKELNQKLTNKNNKIEDLEQEIKIQKQKQETLQEEITSLQSSVQQYEEKNTKIKQLLVKTKKELADSKQAETDHLILQASLKGELEASQQQVEVYKIQLAEITSEKHKIHEHLKTSAEQHQRTLSAYQQRVTALQEECRAAKAEQATVTSEFESYKVRVHNVLKQQKNKSMSQAETEGAKQEREHLEMLIDQLKIKLQDSQNNLQINVSELQTLQSEHDTLLERHNKMLQETVSKEAELREKLCSIQSENMMMKSEHTQTVSQLTSQNEVLRNSFRDQVRHLQEEHRKTVETLQQQLSKMEAQLFQLKNEPTTRSPVSSQQSLKNLRERRNTDLPLLDMHTVTREEGEGMETTDTESVSSASTYTQSLEQLLNSPETKLEPPLWHAEFTKEELVQKLSSTTKSADHLNGLLRETEATNAILMEQIKLLKSEIRRLERNQEREKSAANLEYLKNVLLQFIFLKPGSERERLLPVINTMLQLSPEEKGKLAAVAQGEEENASRSSGWASYLHSWSGLR"
     misc_feature    <329..2836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="Chromosome segregation ATPase [Cell cycle control,
                     cell division, chromosome partitioning]; Region: Smc;
                     COG1196"
                     /db_xref="CDD:224117"
     misc_feature    2075..4411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     misc_feature    4619..4813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="Rab binding domain; Region: Rab_bind; pfam16704"
                     /db_xref="CDD:293309"
     misc_feature    4817..4945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="GRIP domain; Region: GRIP; pfam01465"
                     /db_xref="CDD:279767"
     variation       285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919910894"
     variation       288
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163590196"
     variation       290
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347643379"
     variation       298
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390294066"
     variation       303
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868736677"
     variation       304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1375721086"
     variation       306
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766165187"
     variation       307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285457452"
     variation       309
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376738248"
     variation       315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213677786"
     variation       317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746930580"
     variation       320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757141762"
     variation       322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370827700"
     variation       326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368534626"
     variation       331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769292941"
     variation       337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372290189"
     variation       338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748848872"
     variation       343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768145104"
     variation       348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141520578"
     variation       350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159766911"
     variation       354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761016613"
     variation       355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413708133"
     variation       358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766775912"
     variation       360
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938366734"
     variation       362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776808644"
     variation       365..366
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35216570"
     variation       365
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478498128"
     variation       368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308744812"
     variation       369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868566268"
     variation       374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374790581"
     variation       384
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026821005"
     variation       386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262474465"
     variation       388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759830991"
     variation       396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318255064"
     variation       399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765415439"
     variation       401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373554463"
     variation       402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915570315"
     variation       404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284739793"
     variation       408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1171350569"
     variation       414
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758608147"
     variation       415
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1438722532"
     variation       418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1198919570"
     variation       421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237141922"
     variation       423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456081578"
     variation       427
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764264510"
     variation       428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751556782"
     variation       429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752749562"
     variation       433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558738514"
     variation       438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912540674"
     variation       445
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377697070"
     variation       447
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757094933"
     variation       449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305338654"
     variation       451
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903042861"
     variation       453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170704241"
     variation       455
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781073297"
     variation       462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745692153"
     variation       463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755917409"
     variation       465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779742639"
     variation       472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748938912"
     variation       479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768163382"
     variation       485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330573150"
     variation       490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773788157"
     variation       494
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747569256"
     variation       500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340529074"
     variation       502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218346299"
     variation       504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769277550"
     variation       508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771300150"
     variation       511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759864429"
     variation       515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201591332"
     variation       516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775920739"
     variation       524
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763201366"
     variation       526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243715943"
     variation       529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:539963771"
     variation       532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150351597"
     variation       536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751554456"
     variation       537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208830244"
     variation       539
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421189786"
     variation       542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264689418"
     variation       543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761923647"
     variation       547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767406173"
     variation       556
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390150348"
     variation       560..561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttacagaatcct"
                     /db_xref="dbSNP:1385104343"
     variation       564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552450339"
     variation       565
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755932248"
     variation       569
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779761244"
     variation       574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753498571"
     variation       575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337362392"
     variation       582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246568389"
     variation       586
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265610795"
     variation       588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296769383"
     variation       591
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216625830"
     variation       595
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367729142"
     variation       596
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778423603"
     variation       597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007980786"
     variation       603
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017594058"
     variation       604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649752"
     variation       607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371673633"
     variation       610
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771587101"
     variation       612
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781607007"
     variation       614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746381453"
     variation       618
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758253345"
     variation       621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043247481"
     variation       622
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775949291"
     variation       628
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763300179"
     variation       631
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443343409"
     variation       634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430018040"
     variation       642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564390284"
     variation       645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761858711"
     variation       646
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899169070"
     variation       648
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357778821"
     variation       655
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767632667"
     variation       657
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927482380"
     variation       662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339571489"
     variation       666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215840563"
     variation       669..675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:755348339"
     variation       669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:994906398"
     variation       674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242140413"
     variation       676
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1310875966"
     variation       677
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937580013"
     variation       687
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750335313"
     variation       688
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057397524"
     variation       690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283738431"
     variation       692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774722092"
     variation       694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200754713"
     variation       703
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255214947"
     variation       706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766179585"
     variation       714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375071388"
     variation       716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753586906"
     variation       719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149070749"
     variation       720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439107634"
     variation       724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157395042"
     variation       730
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583148"
     variation       732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752379605"
     variation       734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757912028"
     variation       739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376279109"
     variation       742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302682243"
     variation       745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746374412"
     variation       747
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756649080"
     variation       749
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385557146"
     variation       751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761892796"
     variation       753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749721042"
     variation       754
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463390892"
     variation       755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306999754"
     variation       757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76646082"
     variation       760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233867129"
     variation       763
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558738932"
     variation       765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255245986"
     variation       766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482138219"
     variation       768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774507288"
     variation       772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238954303"
     variation       773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386969618"
     variation       774
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748339477"
     variation       779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1250880284"
     variation       779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178546900"
     variation       782..802
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gag"
                     /replace="gagataaataagttgaacgag"
                     /db_xref="dbSNP:1176920721"
     variation       782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772062666"
     variation       784
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773289345"
     variation       789..791
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1175935875"
     variation       789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760633335"
     variation       793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766341042"
     variation       796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452090498"
     variation       799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776525647"
     variation       800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400490790"
     variation       801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445578874"
     variation       803
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328763222"
     variation       805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382284"
     variation       809
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765075262"
     variation       811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546753702"
     variation       812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310228623"
     variation       814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220165389"
     variation       815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284425608"
     variation       817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763543965"
     variation       820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376224425"
     variation       821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756806500"
     variation       824
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186410906"
     variation       825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385284172"
     variation       827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558739067"
     variation       828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755402448"
     variation       832
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779282384"
     variation       837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748344811"
     variation       841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200408782"
     variation       844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171917691"
     variation       851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558739092"
     variation       852..858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:781322684"
     variation       862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423342495"
     variation       866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773271826"
     variation       868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201596826"
     variation       869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924360145"
     variation       871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553682391"
     variation       872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457914246"
     variation       873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770983017"
     variation       875
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776615615"
     variation       879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759400747"
     variation       890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764953975"
     variation       900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775306593"
     variation       903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217067767"
     variation       905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624813"
     variation       907
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763857256"
     variation       908
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220842965"
     variation       909
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263757051"
     variation       910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:934492136"
     variation       917
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051570715"
     variation       922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489590964"
     variation       923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751245972"
     variation       924
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535556399"
     variation       925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477025570"
     variation       927
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184415942"
     variation       929
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200042988"
     variation       930
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202061636"
     variation       932
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755468422"
     variation       945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741176"
     variation       946
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753141947"
     variation       948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758664500"
     variation       949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539887315"
     variation       951
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397845853"
     variation       961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351554396"
     variation       962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747229762"
     variation       963
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380239386"
     variation       965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771005293"
     variation       967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781192585"
     variation       969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262588948"
     variation       972
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141977454"
     variation       973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218012387"
     variation       979
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769810605"
     variation       981
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405402526"
     variation       983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400602749"
     variation       991
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487522778"
     variation       992
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775266412"
     variation       993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1347129199"
     variation       996
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558193053"
     variation       999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558739320"
     variation       1006
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729897"
     variation       1012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180903332"
     variation       1018
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774149480"
     variation       1020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199925996"
     variation       1023
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159186035"
     variation       1025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767153817"
     variation       1034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927437409"
     variation       1035
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749908800"
     variation       1036
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336007488"
     variation       1040
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760076821"
     variation       1041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1297778289"
     variation       1044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765826004"
     variation       1047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057519387"
     variation       1048
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753133550"
     variation       1052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758866357"
     variation       1053
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481644642"
     variation       1067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1421904421"
     variation       1070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993461340"
     variation       1071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778047476"
     variation       1080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751794952"
     variation       1083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757422255"
     variation       1084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781280877"
     variation       1087
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746008880"
     variation       1089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769748065"
     variation       1090
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240810622"
     variation       1091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193332313"
     variation       1092
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534102235"
     variation       1093
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749110429"
     variation       1094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768508067"
     variation       1098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774235989"
     variation       1103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761585182"
     variation       1105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198814494"
     variation       1116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574072336"
     variation       1123
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048297594"
     variation       1130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316857514"
     variation       1141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771895994"
     variation       1144
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772980641"
     variation       1147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225559696"
     variation       1154
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447793659"
     variation       1156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949032983"
     variation       1157
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375856134"
     variation       1158..1165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1558739486"
     variation       1159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765805903"
     variation       1168
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369977320"
     variation       1170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374737591"
     variation       1179
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753254448"
     variation       1180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1326973625"
     variation       1184..1191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaattaaa"
                     /db_xref="dbSNP:752944414"
     variation       1187
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281990243"
     variation       1194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374813941"
     variation       1198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448662773"
     variation       1203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344757214"
     variation       1204
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393854068"
     variation       1209
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404677344"
     variation       1210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764466155"
     variation       1212
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260381807"
     variation       1222
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751881094"
     variation       1227
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198848160"
     variation       1228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237083074"
     variation       1232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369170580"
     variation       1236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200948483"
     variation       1239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767784682"
     variation       1242
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746003"
     variation       1246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167702345"
     variation       1247..1251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1477651601"
     variation       1247
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197102034"
     variation       1248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048154580"
     variation       1253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555252199"
     variation       1257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466384395"
     variation       1261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773384748"
     variation       1265..1267
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1394461749"
     variation       1265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1444139642"
     variation       1266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779938219"
     variation       1267
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004130499"
     variation       1270
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035232214"
     variation       1273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749267870"
     variation       1274
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006736114"
     variation       1278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1331092618"
     variation       1279
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754922343"
     variation       1281..1285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:756135294"
     variation       1286..1291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atatca"
                     /db_xref="dbSNP:1341495036"
     variation       1287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959784795"
     variation       1288..1291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atca"
                     /db_xref="dbSNP:1218883900"
     variation       1289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778958751"
     variation       1296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1157197068"
     variation       1299
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257604297"
     variation       1300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1336881383"
     variation       1302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022524104"
     variation       1303
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968390662"
     variation       1305
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211043257"
     variation       1309
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748009845"
     variation       1311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760868283"
     variation       1312
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978383532"
     variation       1321..1333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaaaaa"
                     /replace="agaaaaagaaaaa"
                     /db_xref="dbSNP:777760783"
     variation       1325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771983890"
     variation       1327
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478004008"
     variation       1328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193224912"
     variation       1332
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1553438402"
     variation       1333..1343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="attaa"
                     /replace="attaacattaa"
                     /db_xref="dbSNP:745790902"
     variation       1333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147654490"
     variation       1336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772987604"
     variation       1338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746578708"
     variation       1344
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1423349948"
     variation       1347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142684498"
     variation       1354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775957002"
     variation       1356
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140818127"
     variation       1357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943194201"
     variation       1359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038941538"
     variation       1360
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920490239"
     variation       1361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930649631"
     variation       1364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190820622"
     variation       1366
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146700196"
     variation       1367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246499911"
     variation       1373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047693033"
     variation       1374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762231999"
     variation       1376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145247044"
     variation       1378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978819011"
     variation       1387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377604308"
     variation       1390
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149652536"
     variation       1392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185517792"
     variation       1394..1400
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagcaag"
                     /db_xref="dbSNP:1488502523"
     variation       1394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215702024"
     variation       1398..1403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:771974664"
     variation       1403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766508161"
     variation       1404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372937652"
     variation       1406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753899949"
     variation       1408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237970379"
     variation       1413
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556272156"
     variation       1417
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442812086"
     variation       1421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274881421"
     variation       1423..1425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:779888794"
     variation       1426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381407477"
     variation       1427
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419608695"
     variation       1428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779054955"
     variation       1429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748096672"
     variation       1432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758275416"
     variation       1433..1437
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:1558739859"
     variation       1434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777375176"
     variation       1435
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334360314"
     variation       1436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746698287"
     variation       1437
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770450276"
     variation       1438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776316287"
     variation       1439
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745440605"
     variation       1449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183575645"
     variation       1451
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373973137"
     variation       1458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774841781"
     variation       1460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762248388"
     variation       1463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767889211"
     variation       1465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773406502"
     variation       1478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460045507"
     variation       1480..1487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagtcaag"
                     /db_xref="dbSNP:746744919"
     variation       1480..1481
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1442513029"
     variation       1484..1485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:768578200"
     variation       1486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439677984"
     variation       1490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761066885"
     variation       1492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200958316"
     variation       1493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754082179"
     variation       1498..1503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:776384329"
     variation       1499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200270126"
     variation       1500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765343878"
     variation       1502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205671661"
     variation       1503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332839102"
     variation       1507
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752697494"
     variation       1509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758365184"
     variation       1510
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304732223"
     variation       1515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257044582"
     variation       1521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148359301"
     variation       1522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031375413"
     variation       1526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751351993"
     variation       1528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111527126"
     variation       1531
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370488160"
     variation       1534..1540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcag"
                     /replace="gcagcag"
                     /db_xref="dbSNP:1200741086"
     variation       1534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528729535"
     variation       1536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745455759"
     variation       1545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480328029"
     variation       1547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995115"
     variation       1549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769306376"
     variation       1552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434246089"
     variation       1560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490121597"
     variation       1561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748202873"
     variation       1565
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940939996"
     variation       1568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427602721"
     variation       1569..1610
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atg"
                     /replace="atgcccttctcgaaactgtgaatcgcctccagggagaaaatg"
                     /db_xref="dbSNP:1315005166"
     variation       1569
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111613095"
     variation       1573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467952366"
     variation       1574..1578
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1558740067"
     variation       1579
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540949615"
     variation       1580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562126455"
     variation       1584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772493105"
     variation       1586
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352409978"
     variation       1589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176292274"
     variation       1592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377282558"
     variation       1593
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761006452"
     variation       1599
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771325509"
     variation       1601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346503661"
     variation       1603
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305544670"
     variation       1608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282438487"
     variation       1611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776999762"
     variation       1612
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759778171"
     variation       1613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279003695"
     variation       1615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467723931"
     variation       1618
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765431163"
     variation       1621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202595118"
     variation       1628
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752787189"
     variation       1629
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489117399"
     variation       1637
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763095072"
     variation       1639..1640
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1423397180"
     variation       1640
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763988821"
     variation       1641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175972132"
     variation       1643
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751509052"
     variation       1653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195400958"
     variation       1658
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371790236"
     variation       1659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427539820"
     variation       1661
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167781340"
     variation       1670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780981207"
     variation       1672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501385"
     variation       1674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302431416"
     variation       1678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363495038"
     variation       1682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755720124"
     variation       1683
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779646741"
     variation       1685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369626877"
     variation       1686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361609748"
     variation       1697..1706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agtc"
                     /replace="agtctcagtc"
                     /db_xref="dbSNP:761581032"
     variation       1698
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768195223"
     variation       1699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778213807"
     variation       1700
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019082050"
     variation       1701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245928069"
     variation       1712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290135176"
     variation       1713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489482701"
     variation       1714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747487244"
     variation       1715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771216512"
     variation       1716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222504208"
     variation       1717
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485361240"
     variation       1719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1323747305"
     variation       1720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184380647"
     variation       1721
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373780548"
     variation       1723
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:964534174"
     variation       1726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759869953"
     variation       1727
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162868458"
     variation       1738..1740
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:756971621"
     variation       1741
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402462037"
     variation       1744
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383371246"
     variation       1745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770183232"
     variation       1747
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298626440"
     variation       1749
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920522699"
     variation       1750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428913746"
     variation       1755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733788"
     variation       1757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550791699"
     variation       1759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470443354"
     variation       1760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010141859"
     variation       1767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377725944"
     variation       1771
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356545280"
     variation       1775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774169009"
     variation       1779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200008152"
     variation       1781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284064502"
     variation       1794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767246456"
     variation       1796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750255811"
     variation       1797
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426501841"
     variation       1798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773730114"
     variation       1799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371376562"
     variation       1806
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143706341"
     variation       1818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747355682"
     variation       1821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753488471"
     variation       1825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754454908"
     variation       1826
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778431070"
     variation       1827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939317682"
     variation       1835
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282502541"
     variation       1837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139691316"
     variation       1839
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753625999"
     variation       1841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757744857"
     variation       1843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178521867"
     variation       1844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398374320"
     variation       1845
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407187260"
     variation       1847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895191613"
     variation       1850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781756304"
     variation       1854
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948209315"
     variation       1857..1858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:769325355"
     variation       1863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373924982"
     variation       1867..1871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agtag"
                     /db_xref="dbSNP:1379176443"
     variation       1869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448191708"
     variation       1871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145077426"
     variation       1875
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274371671"
     variation       1878..1882
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="caatc"
                     /db_xref="dbSNP:1216852012"
     variation       1878
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770271101"
     variation       1880
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221355978"
     variation       1888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741717"
     variation       1892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749469344"
     variation       1893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024464817"
     variation       1895
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260734243"
     variation       1898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191279740"
     variation       1903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761764768"
     variation       1906
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329552835"
     variation       1909
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031657685"
     variation       1911
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460307482"
     variation       1921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483560293"
     variation       1922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61739749"
     variation       1924..1930
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agga"
                     /replace="aggagga"
                     /db_xref="dbSNP:772664758"
     variation       1926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891475133"
     variation       1928
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740583"
     variation       1929
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767490206"
     variation       1931
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773116841"
     variation       1935
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367881891"
     variation       1936
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411624165"
     variation       1940
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920857758"
     variation       1943..1946
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttaa"
                     /db_xref="dbSNP:1402557746"
     variation       1944..1948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="taaaa"
                     /db_xref="dbSNP:763502591"
     variation       1944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182461304"
     variation       1945..1954
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaag"
                     /replace="aaaagaaaag"
                     /db_xref="dbSNP:766736753"
     variation       1950
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353341747"
     variation       1955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439184703"
     variation       1958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140310167"
     variation       1959
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345221071"
     variation       1960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766099385"
     variation       1962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555677090"
     variation       1965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740656"
     variation       1969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576244953"
     variation       1973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764688075"
     variation       1979
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752293612"
     variation       1982
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436046060"
     variation       1985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757826462"
     variation       1986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182645789"
     variation       1987
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372074612"
     variation       1988
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150938411"
     variation       1999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749502433"
     variation       2000
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475864400"
     variation       2001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150078317"
     variation       2002
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394396750"
     variation       2003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376990612"
     variation       2007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304241885"
     variation       2013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772129982"
     variation       2015..2020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:759852289"
     variation       2015..2017
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:752109794"
     variation       2015
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226547497"
     variation       2020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403426657"
     variation       2021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773135239"
     variation       2023
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141805666"
     variation       2024
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391057767"
     variation       2034..2035
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:767887598"
     variation       2034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1269123750"
     variation       2035
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369088854"
     variation       2040
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298541997"
     variation       2041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372865093"
     variation       2043
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200389027"
     variation       2047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577283127"
     variation       2048
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375946212"
     variation       2049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759222318"
     variation       2058
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61741893"
     variation       2060..2064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:752891062"
     variation       2061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764991505"
     variation       2068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762619155"
     variation       2073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945879082"
     variation       2076..2083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:756364486"
     variation       2076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763638702"
     variation       2080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406749496"
     variation       2084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750989248"
     variation       2091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371440005"
     variation       2096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1473780638"
     variation       2104..2105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1164785165"
     variation       2105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558740890"
     variation       2106..2112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:777909420"
     variation       2110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776466243"
     variation       2112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780392284"
     variation       2118..2122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1160864211"
     variation       2118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754274589"
     variation       2119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186457569"
     variation       2121..2127
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:553103180"
     variation       2125
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779257690"
     variation       2126
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748248613"
     variation       2129
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772156346"
     variation       2130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358697601"
     variation       2135
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777785198"
     variation       2138..2143
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:757374682"
     variation       2141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259075581"
     variation       2145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368592749"
     variation       2147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770899061"
     variation       2148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372319248"
     variation       2155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776412280"
     variation       2159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759260339"
     variation       2162..2166
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:779791241"
     variation       2164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444328870"
     variation       2169..2170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1230076424"
     variation       2176
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290111450"
     variation       2188
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759436302"
     variation       2189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242578153"
     variation       2191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769472880"
     variation       2194..2198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="taatt"
                     /db_xref="dbSNP:746975961"
     variation       2196
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364766321"
     variation       2210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553327544"
     variation       2217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762645439"
     variation       2219
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405508254"
     variation       2222
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992533570"
     variation       2223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741028"
     variation       2225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763728337"
     variation       2234..2238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttatt"
                     /db_xref="dbSNP:1392708707"
     variation       2237
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138472765"
     variation       2238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761384692"
     variation       2239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916577022"
     variation       2243
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364082251"
     variation       2245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381340267"
     variation       2251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766964266"
     variation       2256
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750341029"
     variation       2258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336144112"
     variation       2264
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1238134261"
     variation       2265..2266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1258733483"
     variation       2267..2273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaagaaa"
                     /db_xref="dbSNP:1055792867"
     variation       2273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325973107"
     variation       2275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755370564"
     variation       2279
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260191310"
     variation       2280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779086346"
     variation       2281
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752942121"
     variation       2289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181053232"
     variation       2293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251796166"
     variation       2296..2297
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="caa"
                     /db_xref="dbSNP:1419002672"
     variation       2297..2298
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1382806587"
     variation       2303
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758583225"
     variation       2304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379714687"
     variation       2307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757883913"
     variation       2308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741151"
     variation       2311..2317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /db_xref="dbSNP:768523280"
     variation       2311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948157020"
     variation       2313
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223836489"
     variation       2318
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764900269"
     variation       2321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376201616"
     variation       2323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293344874"
     variation       2324
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467722939"
     variation       2329
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014322616"
     variation       2330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781259774"
     variation       2335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368499106"
     variation       2336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540561575"
     variation       2342
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347103200"
     variation       2343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558741197"
     variation       2347..2348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1224383207"
     variation       2348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147267352"
     variation       2355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749060582"
     variation       2359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1321520535"
     variation       2362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768472292"
     variation       2370
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62000420"
     variation       2374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962155514"
     variation       2378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761471420"
     variation       2387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766868631"
     variation       2388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777206295"
     variation       2391
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373358076"
     variation       2392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480930422"
     variation       2395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199715610"
     variation       2399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765668476"
     variation       2402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377548265"
     variation       2404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558741259"
     variation       2405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293995034"
     variation       2406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263972654"
     variation       2409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774873391"
     variation       2412
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181789592"
     variation       2418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479248738"
     variation       2423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202022886"
     variation       2425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964071112"
     variation       2427
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461440891"
     variation       2429..2432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1296335720"
     variation       2434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380536974"
     variation       2439
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758744395"
     variation       2441
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374201747"
     variation       2444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751776542"
     variation       2447
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302288457"
     variation       2449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757364490"
     variation       2450
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052721221"
     variation       2452
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781076781"
     variation       2456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296418496"
     variation       2462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1366183315"
     variation       2462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745847876"
     variation       2465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306956276"
     variation       2467
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147227525"
     variation       2468..2472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1558741343"
     variation       2471
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780117635"
     variation       2474
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294514823"
     variation       2476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490652955"
     variation       2483
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222296847"
     variation       2484
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749153398"
     variation       2485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367728508"
     variation       2487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741376"
     variation       2494
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370623394"
     variation       2498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747741971"
     variation       2499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771631848"
     variation       2500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168245988"
     variation       2503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336979954"
     variation       2507
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387071496"
     variation       2508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361987402"
     variation       2509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1040053435"
     variation       2510
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560484"
     variation       2513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760204378"
     variation       2514..2519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agttag"
                     /db_xref="dbSNP:781183137"
     variation       2516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162752039"
     variation       2518
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563097138"
     variation       2523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201325666"
     variation       2527..2529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:925811579"
     variation       2528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775964196"
     variation       2529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139623765"
     variation       2535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146256742"
     variation       2536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751795034"
     variation       2541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757380227"
     variation       2543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392507603"
     variation       2544
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144062162"
     variation       2545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894451722"
     variation       2546
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444078397"
     variation       2547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951929244"
     variation       2550
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319064296"
     variation       2554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527733249"
     variation       2555
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014683399"
     variation       2557..2562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tct"
                     /replace="tcttct"
                     /db_xref="dbSNP:747772330"
     variation       2558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005083150"
     variation       2564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485331180"
     variation       2567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536516536"
     variation       2568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186194933"
     variation       2569..2574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaa"
                     /replace="gaagaa"
                     /db_xref="dbSNP:1202843350"
     variation       2571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244424916"
     variation       2573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567813236"
     variation       2574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149051213"
     variation       2575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749167273"
     variation       2577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243229382"
     variation       2587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200328829"
     variation       2589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014849447"
     variation       2590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778799262"
     variation       2591
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747868838"
     variation       2592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451858435"
     variation       2598
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771664379"
     variation       2601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777463225"
     variation       2605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452583533"
     variation       2607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313471572"
     variation       2609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992073362"
     variation       2610..2613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1558741601"
     variation       2611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376001079"
     variation       2613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373019080"
     variation       2621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224741919"
     variation       2624..2630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:769389279"
     variation       2627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746562390"
     variation       2629..2632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="agta"
                     /db_xref="dbSNP:772930314"
     variation       2632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424149870"
     variation       2634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385964891"
     variation       2636
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775980873"
     variation       2638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763395652"
     variation       2641..2642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1182556330"
     variation       2641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993580082"
     variation       2650
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235725178"
     variation       2655
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027769388"
     variation       2659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769032581"
     variation       2661
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916608229"
     variation       2662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406948239"
     variation       2666..2677
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaaaaa"
                     /replace="gaaaaagaaaaa"
                     /db_xref="dbSNP:1471744452"
     variation       2668
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178798839"
     variation       2672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774737186"
     variation       2678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762213492"
     variation       2692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374523392"
     variation       2697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1490152565"
     variation       2701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750652114"
     variation       2702
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151131536"
     variation       2704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766504781"
     variation       2707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567509759"
     variation       2712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147113988"
     variation       2717
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284743129"
     variation       2722
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322611947"
     variation       2727
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778966752"
     variation       2732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222443730"
     variation       2733
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751461574"
     variation       2738..2742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1439543677"
     variation       2742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205071225"
     variation       2744
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902683816"
     variation       2745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481909936"
     variation       2746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371074235"
     variation       2752
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:925335557"
     variation       2753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777356661"
     variation       2754
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746606214"
     variation       2755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029375087"
     variation       2758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142522262"
     variation       2759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780634068"
     variation       2760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366658848"
     variation       2765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748627738"
     variation       2768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769572125"
     variation       2769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772341027"
     variation       2771
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138827624"
     variation       2772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771330093"
     variation       2773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933489795"
     variation       2774
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362992732"
     variation       2775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775165071"
     variation       2781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248048275"
     variation       2786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182216335"
     variation       2787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144683999"
     variation       2788
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1292269123"
     variation       2792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188078487"
     variation       2795
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776983164"
     variation       2797
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759759979"
     variation       2802..2805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1208301358"
     variation       2806
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286683427"
     variation       2808
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249613038"
     variation       2810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765298197"
     variation       2812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558742437"
     variation       2814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965465988"
     variation       2815..2818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1417198054"
     variation       2815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304894"
     variation       2821..2825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gttgg"
                     /db_xref="dbSNP:1246244416"
     variation       2822
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042628793"
     variation       2826..2827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1447003740"
     variation       2828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184707117"
     variation       2836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762900631"
     variation       2838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761600051"
     variation       2839
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260851474"
     variation       2845
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218124658"
     variation       2847..2851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1251727905"
     variation       2847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767241149"
     variation       2848
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184094290"
     variation       2852..2856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gaatg"
                     /db_xref="dbSNP:981067132"
     variation       2852
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750094291"
     variation       2854
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751037716"
     variation       2855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234487157"
     variation       2862..2863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1480106752"
     variation       2864..2866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1409395750"
     variation       2866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182135420"
     variation       2870
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755719987"
     variation       2872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765913754"
     variation       2875
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1464512757"
     variation       2879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197336886"
     variation       2880
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753434393"
     variation       2881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374554854"
     variation       2885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370690279"
     variation       2899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754436218"
     variation       2900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778414438"
     variation       2901
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775133111"
     variation       2905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741301"
     variation       2906
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201533301"
     variation       2908..2917
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaagaa"
                     /replace="aaagaaagaa"
                     /db_xref="dbSNP:1379177165"
     variation       2911
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300703183"
     variation       2916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310476331"
     variation       2921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230280873"
     variation       2923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540350740"
     variation       2925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770097002"
     variation       2926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749450889"
     variation       2940
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804002"
     variation       2941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778920396"
     variation       2943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748191151"
     variation       2948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772043861"
     variation       2952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369476264"
     variation       2954
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163802954"
     variation       2956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478364800"
     variation       2965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348399041"
     variation       2966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773117197"
     variation       2967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760588617"
     variation       2968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770568579"
     variation       2972
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1481167189"
     variation       2973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776363038"
     variation       2975
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764871527"
     variation       2977
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200632066"
     variation       2978..2985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ga"
                     /replace="gaaaagga"
                     /db_xref="dbSNP:1294024072"
     variation       2982
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963686194"
     variation       2983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775180642"
     variation       2985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992064468"
     variation       2993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373531562"
     variation       2996
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228174598"
     variation       3001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310983408"
     variation       3002
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:974061040"
     variation       3007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768202885"
     variation       3008
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756514438"
     variation       3010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199582186"
     variation       3012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400799163"
     variation       3014
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766603690"
     variation       3017
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333097633"
     variation       3029
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463993580"
     variation       3030
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015529394"
     variation       3032
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754116992"
     variation       3033
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112414104"
     variation       3044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765508224"
     variation       3045
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752852118"
     variation       3049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402766997"
     variation       3058
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200698017"
     variation       3059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345028400"
     variation       3066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218593126"
     variation       3067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276494505"
     variation       3068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309185054"
     variation       3079
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043026548"
     variation       3080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423737921"
     variation       3081
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777666786"
     variation       3084..3088
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1173525178"
     variation       3088
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250765827"
     variation       3092
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746999034"
     variation       3093
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145961164"
     variation       3096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745710611"
     variation       3107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769643756"
     variation       3109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748897129"
     variation       3110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768308979"
     variation       3112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773774486"
     variation       3113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199920630"
     variation       3114
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139373750"
     variation       3116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777189992"
     variation       3117
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325051408"
     variation       3118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558748773"
     variation       3130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961545411"
     variation       3131
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331317699"
     variation       3135..3140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aattaa"
                     /db_xref="dbSNP:1297922376"
     variation       3139..3143
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:755939952"
     variation       3139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759901263"
     variation       3145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369977045"
     variation       3147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765528847"
     variation       3148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752940087"
     variation       3153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008229275"
     variation       3156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273683937"
     variation       3159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161025040"
     variation       3170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763285911"
     variation       3177
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1166742035"
     variation       3179..3184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:1462193829"
     variation       3180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760393036"
     variation       3182..3186
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ga"
                     /replace="gaaga"
                     /db_xref="dbSNP:1319298198"
     variation       3189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764284016"
     variation       3195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397662496"
     variation       3197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150549327"
     variation       3198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761805619"
     variation       3199
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767581549"
     variation       3201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139867631"
     variation       3206
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750413831"
     variation       3212
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1196396069"
     variation       3214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400697261"
     variation       3226..3232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atta"
                     /replace="attatta"
                     /db_xref="dbSNP:1558749221"
     variation       3227
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762166594"
     variation       3230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766073111"
     variation       3232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266296314"
     variation       3236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271461409"
     variation       3244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385757799"
     variation       3246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326304266"
     variation       3250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231267860"
     variation       3251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271988906"
     variation       3255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370403999"
     variation       3256
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333849411"
     variation       3259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780117653"
     variation       3269
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141225250"
     variation       3270
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978616285"
     variation       3271
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540191458"
     variation       3275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778432512"
     variation       3276
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561373947"
     variation       3282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450117592"
     variation       3292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1472695864"
     variation       3294
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771506645"
     variation       3299
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777225487"
     variation       3302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746492141"
     variation       3304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173033029"
     variation       3310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770339104"
     variation       3311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775966369"
     variation       3313
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112143014"
     variation       3315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309592184"
     variation       3324
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1302222404"
     variation       3325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249329980"
     variation       3327
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387197812"
     variation       3330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772479486"
     variation       3331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209968900"
     variation       3332
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773563468"
     variation       3333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766506745"
     variation       3336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112971525"
     variation       3338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759479296"
     variation       3346
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448704314"
     variation       3347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440973448"
     variation       3350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166476755"
     variation       3352
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765054604"
     variation       3356
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190032468"
     variation       3358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238462585"
     variation       3361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752586160"
     variation       3362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758118731"
     variation       3364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361037016"
     variation       3367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388586464"
     variation       3368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763805735"
     variation       3371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751148636"
     variation       3376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756776491"
     variation       3377
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2718698"
     variation       3380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315251271"
     variation       3386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776376279"
     variation       3388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764254276"
     variation       3389
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142611820"
     variation       3395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414857869"
     variation       3399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755553644"
     variation       3401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260090078"
     variation       3402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533881757"
     variation       3403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779270856"
     variation       3409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1458299039"
     variation       3410
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748611623"
     variation       3413
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151289779"
     variation       3416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778153215"
     variation       3419
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747178123"
     variation       3422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1415631486"
     variation       3423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424647828"
     variation       3428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1325419433"
     variation       3431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312668795"
     variation       3433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761579405"
     variation       3436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277861717"
     variation       3442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767262699"
     variation       3446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749975866"
     variation       3449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760245435"
     variation       3453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765755225"
     variation       3463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192991650"
     variation       3476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426537811"
     variation       3477
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753276945"
     variation       3479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172190231"
     variation       3482
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372757727"
     variation       3487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759015773"
     variation       3495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927576463"
     variation       3499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150423177"
     variation       3502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142777791"
     variation       3503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439441831"
     variation       3511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276083510"
     variation       3515..3522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aacaa"
                     /replace="aacaacaa"
                     /db_xref="dbSNP:746365647"
     variation       3519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303050399"
     variation       3520
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143737097"
     variation       3523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781485417"
     variation       3524
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005737514"
     variation       3527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300981933"
     variation       3528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343962219"
     variation       3536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202439691"
     variation       3542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866490440"
     variation       3544
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205597910"
     variation       3548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746022977"
     variation       3551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039516171"
     variation       3552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756242710"
     variation       3553
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779960812"
     variation       3554..3561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="caaaaaca"
                     /db_xref="dbSNP:1558750723"
     variation       3560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749344356"
     variation       3562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375968480"
     variation       3568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423306291"
     variation       3569
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965819512"
     variation       3573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774263627"
     variation       3574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456568396"
     variation       3575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747941337"
     variation       3580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168319647"
     variation       3581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418410717"
     variation       3584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279630183"
     variation       3587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753889331"
     variation       3588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340034632"
     variation       3589..3590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:760543706"
     variation       3591
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383278698"
     variation       3594
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164577647"
     variation       3595
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371419991"
     variation       3599
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748029412"
     variation       3601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162137907"
     variation       3606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390811870"
     variation       3608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439976770"
     variation       3610..3616
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1026397447"
     variation       3612
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771930600"
     variation       3615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201741171"
     variation       3617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746798568"
     variation       3621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770550098"
     variation       3624..3630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:760884932"
     variation       3626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776419181"
     variation       3630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334403676"
     variation       3631
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759122367"
     variation       3632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558751667"
     variation       3638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764785824"
     variation       3639
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762189707"
     variation       3643
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768039941"
     variation       3650
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260097871"
     variation       3653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369363942"
     variation       3656..3659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1409085692"
     variation       3660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371706600"
     variation       3664
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376460288"
     variation       3667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237737956"
     variation       3668
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474665198"
     variation       3670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766588884"
     variation       3671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753998058"
     variation       3673..3674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1457709646"
     variation       3674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306024671"
     variation       3675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157870118"
     variation       3678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368958563"
     variation       3685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369747246"
     variation       3689
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334538821"
     variation       3691
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762300159"
     variation       3694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759793368"
     variation       3701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765421952"
     variation       3712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234557370"
     variation       3714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050094389"
     variation       3715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1303138344"
     variation       3718
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752777880"
     variation       3732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418859139"
     variation       3741
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201346948"
     variation       3746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888743151"
     variation       3751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276418795"
     variation       3755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480741796"
     variation       3757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203441758"
     variation       3761
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277281384"
     variation       3764..3767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1483652197"
     variation       3764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194756808"
     variation       3765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376638817"
     variation       3770
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388589708"
     variation       3771
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1348990551"
     variation       3779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779584230"
     variation       3785
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533500477"
     variation       3786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010946455"
     variation       3789..3793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="catca"
                     /db_xref="dbSNP:1051912718"
     variation       3789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332631187"
     variation       3792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754477036"
     variation       3800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778523077"
     variation       3801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485455575"
     variation       3807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021365021"
     variation       3808
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031269477"
     variation       3809
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404396524"
     variation       3810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346459110"
     variation       3811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747634829"
     variation       3812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144078912"
     variation       3814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111823638"
     variation       3815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41280574"
     variation       3820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457744633"
     variation       3825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954168656"
     variation       3828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548223516"
     variation       3829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414066111"
     variation       3830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770087901"
     variation       3831
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147550431"
     variation       3832
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763198265"
     variation       3834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452133427"
     variation       3836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304934172"
     variation       3841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380914128"
     variation       3843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444883031"
     variation       3845
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985615983"
     variation       3846
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369984459"
     variation       3847..3862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tac"
                     /replace="tacgctaagtgcatac"
                     /db_xref="dbSNP:1558752584"
     variation       3849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774543551"
     variation       3850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149849446"
     variation       3857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767562609"
     variation       3858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345819253"
     variation       3859
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1284954649"
     variation       3862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750323927"
     variation       3865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755993632"
     variation       3869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1061202"
     variation       3870
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257498831"
     variation       3872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766154317"
     variation       3873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210366792"
     variation       3881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753544225"
     variation       3884
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249531562"
     variation       3886
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754707101"
     variation       3888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177816192"
     variation       3889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373111221"
     variation       3890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747724362"
     variation       3892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449777234"
     variation       3895
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178735235"
     variation       3896
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567930302"
     variation       3897
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918884510"
     variation       3899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929060807"
     variation       3900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377405233"
     variation       3904
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746326735"
     variation       3909
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206287208"
     variation       3911
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374497002"
     variation       3914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148977033"
     variation       3922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407752377"
     variation       3923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776365638"
     variation       3927
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368522198"
     variation       3932
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440025107"
     variation       3934
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034665624"
     variation       3937
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141270164"
     variation       3938
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327923712"
     variation       3954
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431185464"
     variation       3955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959267073"
     variation       3957
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752379912"
     variation       3958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762637740"
     variation       3959
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036170628"
     variation       3960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763715849"
     variation       3965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751132179"
     variation       3968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756721047"
     variation       3974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780621282"
     variation       3982..3989
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaat"
                     /replace="aaataaat"
                     /db_xref="dbSNP:1364076790"
     variation       3984
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144995786"
     variation       3987
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755398917"
     variation       3990
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867744399"
     variation       3991..3993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1447137543"
     variation       3991
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474192067"
     variation       3992
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537417442"
     variation       3993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748498789"
     variation       4001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460872821"
     variation       4003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772479263"
     variation       4005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:915000290"
     variation       4010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141811180"
     variation       4012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770858790"
     variation       4013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776653662"
     variation       4014
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188112234"
     variation       4015
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759353170"
     variation       4016
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769689840"
     variation       4022
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1553442136"
     variation       4035
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373591045"
     variation       4044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280652233"
     variation       4046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769785023"
     variation       4048
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775406077"
     variation       4051..4054
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgac"
                     /db_xref="dbSNP:1396995824"
     variation       4056
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768387950"
     variation       4064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420302565"
     variation       4068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175646405"
     variation       4070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048526317"
     variation       4072
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762001026"
     variation       4073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761409091"
     variation       4076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:889959359"
     variation       4078
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455451585"
     variation       4084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767174442"
     variation       4087
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394727280"
     variation       4094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201598096"
     variation       4099
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760256265"
     variation       4102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765843796"
     variation       4105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939766734"
     variation       4107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1390875585"
     variation       4108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212522497"
     variation       4112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753198031"
     variation       4114
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372100844"
     variation       4116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442166911"
     variation       4117
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12104502"
     variation       4120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895614689"
     variation       4126
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280481528"
     variation       4132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226027616"
     variation       4133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751922360"
     variation       4134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901467304"
     variation       4139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550647621"
     variation       4140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781465261"
     variation       4142
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569137853"
     variation       4144
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194705666"
     variation       4145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773834644"
     variation       4148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779983908"
     variation       4152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044734650"
     variation       4153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904420878"
     variation       4155..4161
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1484081118"
     variation       4155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000234141"
     variation       4158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749179357"
     variation       4159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143480889"
     variation       4162
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200823043"
     variation       4163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031666308"
     variation       4164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774060667"
     variation       4165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747959489"
     variation       4168
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370787694"
     variation       4170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772853681"
     variation       4174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325657570"
     variation       4175
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532944652"
     variation       4177..4181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:771577824"
     variation       4178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761073703"
     variation       4180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213272486"
     variation       4191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558755166"
     variation       4192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373039945"
     variation       4193
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1326630594"
     variation       4194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776172312"
     variation       4199
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201191345"
     variation       4200
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764642889"
     variation       4202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376647881"
     variation       4204
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235617480"
     variation       4213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369225049"
     variation       4217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760933546"
     variation       4225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363521410"
     variation       4232..4241
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atgatga"
                     /replace="atgatgatga"
                     /db_xref="dbSNP:1558756688"
     variation       4233
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452057912"
     variation       4235
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367437976"
     variation       4237
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766572412"
     variation       4238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374912295"
     variation       4242
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755016874"
     variation       4245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778728618"
     variation       4246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376925926"
     variation       4253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:754762170"
     variation       4254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370316650"
     variation       4255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368044415"
     variation       4257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237686107"
     variation       4260
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282793986"
     variation       4261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577919832"
     variation       4262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028058886"
     variation       4264
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545008599"
     variation       4266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745378850"
     variation       4268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374403850"
     variation       4270
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774746560"
     variation       4272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748725727"
     variation       4273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772413848"
     variation       4280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041395116"
     variation       4284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756740240"
     variation       4285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150908938"
     variation       4286
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766656471"
     variation       4288
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174750876"
     variation       4290
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356880494"
     variation       4292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759584353"
     variation       4295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298747880"
     variation       4296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765328971"
     variation       4302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901600438"
     variation       4304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444331771"
     variation       4307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752679442"
     variation       4308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139394961"
     variation       4312
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116357144"
     variation       4315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276752529"
     variation       4316
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350870505"
     variation       4318
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751403336"
     variation       4319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205268592"
     variation       4320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757110639"
     variation       4322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781045802"
     variation       4323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367971760"
     variation       4325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253949910"
     variation       4326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755615332"
     variation       4333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572029170"
     variation       4334
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143689284"
     variation       4337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422620950"
     variation       4338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411197349"
     variation       4343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297922860"
     variation       4345
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170510108"
     variation       4349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200216159"
     variation       4350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376989193"
     variation       4357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773706329"
     variation       4358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371532273"
     variation       4370
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747433973"
     variation       4376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273335952"
     variation       4380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364320233"
     variation       4381
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252477551"
     variation       4383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771264998"
     variation       4385
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776879822"
     variation       4390
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316600646"
     variation       4393
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430049655"
     variation       4396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1216036588"
     variation       4398
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178726008"
     variation       4400
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481353761"
     variation       4401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421414425"
     variation       4402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274345577"
     variation       4405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765328188"
     variation       4413
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219786909"
     variation       4414
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73954367"
     variation       4418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189551783"
     variation       4426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243175854"
     variation       4428..4429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1296459600"
     variation       4428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781636962"
     variation       4430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746160286"
     variation       4431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223545372"
     variation       4433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531054649"
     variation       4437
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775568817"
     variation       4439..4444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="caa"
                     /replace="caacaa"
                     /db_xref="dbSNP:1340316463"
     variation       4439
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763147628"
     variation       4444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768831588"
     variation       4451
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959631427"
     variation       4458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257526463"
     variation       4461
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774466917"
     variation       4471
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185404663"
     variation       4483
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761869351"
     variation       4485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767509179"
     variation       4486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750240618"
     variation       4487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760385592"
     variation       4490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766115496"
     variation       4493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248568495"
     variation       4496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753413117"
     variation       4497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188110040"
     variation       4498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754523898"
     variation       4500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752155049"
     variation       4502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757774345"
     variation       4509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436135836"
     variation       4511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781484576"
     variation       4512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746309826"
     variation       4513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307478750"
     variation       4517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770040610"
     variation       4528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780369989"
     variation       4532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256210402"
     variation       4533
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1374336917"
     variation       4534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749486775"
     variation       4539
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768956209"
     variation       4541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774589902"
     variation       4545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438277120"
     variation       4546
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138104724"
     variation       4548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236069384"
     variation       4549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772206642"
     variation       4553
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194571762"
     variation       4554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773011911"
     variation       4559
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274176758"
     variation       4561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760568596"
     variation       4562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185324754"
     variation       4563
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759208782"
     variation       4564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143575824"
     variation       4569
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199725467"
     variation       4571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558758722"
     variation       4572
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:749732214"
     variation       4573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757898709"
     variation       4574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200660208"
     variation       4575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442095768"
     variation       4577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416388254"
     variation       4578
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138424495"
     variation       4585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330130693"
     variation       4589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2581003"
     variation       4594
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756539110"
     variation       4600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144417032"
     variation       4603
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397950400"
     variation       4604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749616693"
     variation       4605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1256071663"
     variation       4606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779277462"
     variation       4607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748300058"
     variation       4610
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772025871"
     variation       4611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773243301"
     variation       4615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431613238"
     variation       4617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437002354"
     variation       4619
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746952740"
     variation       4622
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969076325"
     variation       4626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755384181"
     variation       4630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360736429"
     variation       4631
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779330631"
     variation       4649
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748351323"
     variation       4651
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758608703"
     variation       4654
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777738290"
     variation       4657
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311904753"
     variation       4665
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472034310"
     variation       4669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981817639"
     variation       4672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319778247"
     variation       4673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747054340"
     variation       4674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770777260"
     variation       4678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375938109"
     variation       4679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1369387402"
     variation       4680
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369103752"
     variation       4685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769552985"
     variation       4690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775160504"
     variation       4691
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345401491"
     variation       4696
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558759874"
     variation       4697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160137279"
     variation       4699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762541556"
     variation       4705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144495063"
     variation       4706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202137644"
     variation       4707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461448985"
     variation       4709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143736607"
     variation       4711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759383108"
     variation       4715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767055452"
     variation       4716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754377499"
     variation       4720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760021247"
     variation       4721
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962965333"
     variation       4722
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376807294"
     variation       4724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458525248"
     variation       4726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151279248"
     variation       4731
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372494251"
     variation       4733
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339597888"
     variation       4734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375902750"
     variation       4735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769563464"
     variation       4737
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758562754"
     variation       4739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201562035"
     variation       4741
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751656837"
     variation       4742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757346184"
     variation       4745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238176179"
     variation       4746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149984837"
     variation       4750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745773198"
     variation       4751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769675542"
     variation       4753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934787189"
     variation       4755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481881620"
     variation       4756
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761542390"
     variation       4767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199941915"
     variation       4777..4783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1325234993"
     variation       4782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350687347"
     variation       4784
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435952862"
     variation       4786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291986925"
     variation       4789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364254522"
     variation       4796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375973636"
     variation       4797..4798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:757019468"
     variation       4799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219295755"
     variation       4800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200853100"
     variation       4802
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454949839"
     variation       4803
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2699606"
     variation       4805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756053867"
     variation       4807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009143044"
     variation       4808
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2699607"
     variation       4814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451838089"
     variation       4818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274419167"
     variation       4819
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:778474782"
     variation       4821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749099848"
     variation       4822
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768479402"
     variation       4823
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2699608"
     variation       4825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772865333"
     variation       4827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446250837"
     variation       4828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760196838"
     variation       4829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770490160"
     variation       4830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194880312"
     variation       4832
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776050782"
     variation       4835..4836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1404545581"
     variation       4836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480641945"
     variation       4837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162997344"
     variation       4840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763275377"
     variation       4841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764485893"
     variation       4846
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297615490"
     variation       4847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339098486"
     variation       4849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536194673"
     variation       4851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:750108950"
     variation       4851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359305813"
     variation       4855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356175716"
     variation       4856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226938032"
     variation       4858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148913935"
     variation       4860
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750502612"
     variation       4861
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756176428"
     variation       4864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766280294"
     variation       4867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487014080"
     variation       4870
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189616936"
     variation       4876
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392168040"
     variation       4879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753779875"
     variation       4880..4888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaga"
                     /replace="agagaga"
                     /replace="agagagaga"
                     /db_xref="dbSNP:757858017"
     variation       4881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754834814"
     variation       4884
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778792617"
     variation       4886
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747841510"
     variation       4888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1382433985"
     variation       4892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364837753"
     variation       4896
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758128317"
     variation       4897
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777563814"
     variation       4899..4900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:779589052"
     variation       4902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416240957"
     variation       4905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361866767"
     variation       4908
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746575083"
     variation       4909
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770543014"
     variation       4912
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1446316699"
     variation       4919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311831005"
     variation       4921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378669813"
     variation       4923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775899833"
     variation       4926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476863005"
     variation       4927
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749832089"
     variation       4928
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768992646"
     variation       4930
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201651444"
     variation       4935
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175253968"
     variation       4945..4949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgctg"
                     /db_xref="dbSNP:747445128"
     variation       4947
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225371530"
     variation       4950
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348912440"
     variation       4951
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201857128"
     variation       4956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240259834"
     variation       4962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572432590"
     variation       4963
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780774991"
     variation       4968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745310946"
     variation       4970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769206694"
     variation       4974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253258219"
     variation       4978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283995110"
     variation       4980
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449274621"
     variation       4981
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200257241"
     variation       4982
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448580295"
     variation       4983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148220751"
     variation       4993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1429175725"
     variation       4996
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477078252"
     variation       5001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772397145"
     variation       5004
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424940430"
     variation       5007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773530396"
     variation       5008
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329679925"
     variation       5010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393885010"
     variation       5011
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760913258"
     variation       5013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323794297"
     variation       5016
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330074691"
     variation       5019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221123431"
     variation       5021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044948041"
     variation       5026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771001974"
     variation       5027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185024170"
     variation       5028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259173887"
     variation       5032..5033
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:748622809"
     variation       5048
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759532918"
     variation       5049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210730955"
     variation       5052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266901132"
     variation       5053
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765277966"
     variation       5054
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752658558"
     variation       5059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1482403797"
     variation       5060
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264569024"
     variation       5062
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477742567"
     variation       5064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169004358"
     variation       5066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762879219"
     variation       5067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1458732997"
     variation       5069..5071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1163525932"
     variation       5070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764011155"
     variation       5072
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368402498"
     variation       5073..5075
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:770259216"
     variation       5075
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751350275"
     variation       5077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370909395"
     variation       5082
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780639205"
     variation       5083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399387727"
     variation       5084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750013741"
     variation       5087
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450641795"
     variation       5090
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286626146"
     variation       5091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189410445"
     variation       5093
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545857578"
     variation       5098..5102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ac"
                     /replace="accac"
                     /db_xref="dbSNP:1351142376"
     variation       5102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962888913"
     variation       5115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975989583"
     variation       5117
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348019973"
     variation       5120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558055277"
     variation       5125..5131
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tatat"
                     /replace="tatatat"
                     /db_xref="dbSNP:1230148458"
     variation       5137..5160
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="catcta"
                     /replace="catctacatatatttgtacatcta"
                     /db_xref="dbSNP:775671773"
     variation       5138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271466805"
     variation       5139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955617899"
     variation       5140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573020322"
     variation       5143
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987036827"
     variation       5144
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178397875"
     variation       5146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911544223"
     variation       5153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181654071"
     variation       5155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987882981"
     variation       5158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186776070"
     variation       5160
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529050333"
     variation       5170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533466887"
     variation       5178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1309475632"
     variation       5185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1217543675"
     variation       5188
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:62148108"
     variation       5189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1292804203"
     variation       5202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437144252"
     variation       5205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1396342090"
     variation       5207
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558766717"
     variation       5216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532969674"
     variation       5217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318268610"
     variation       5218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551059280"
     variation       5219..5223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttgat"
                     /replace="ttgatttgat"
                     /db_xref="dbSNP:1553445816"
     variation       5219..5220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1218060426"
     variation       5221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056424582"
     variation       5225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:62148109"
     variation       5228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192247419"
     variation       5230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455987030"
     variation       5239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172454520"
     variation       5247..5248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1208466301"
     variation       5247
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403634202"
     variation       5251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528751208"
     variation       5253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016981690"
     variation       5254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73954369"
     variation       5256
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236652584"
     variation       5259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336300674"
     variation       5260
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295398911"
     variation       5265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434067400"
     variation       5266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407165430"
     variation       5268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450503579"
     variation       5269
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191216410"
     variation       5270
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1464261914"
     variation       5272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268444715"
     variation       5280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361372018"
     variation       5283
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358026210"
     variation       5284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176133268"
     variation       5285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028429691"
     variation       5287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388854394"
     variation       5298
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955566135"
     variation       5302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13386343"
     variation       5308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1264335575"
     variation       5310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986982843"
     variation       5311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031900776"
     variation       5317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256851996"
     variation       5321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55720651"
     variation       5326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569225412"
     variation       5327
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914948277"
     variation       5328..5330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1227576409"
     variation       5332
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326769329"
     variation       5337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539835398"
     variation       5338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968201318"
     variation       5340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377952805"
     variation       5345
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313187438"
     variation       5347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416079569"
     variation       5349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368181213"
     variation       5351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866792649"
     variation       5357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462963388"
     variation       5358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240945343"
     variation       5369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112191045"
     variation       5370
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1475495914"
     variation       5380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423661350"
     variation       5381
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1195740677"
     variation       5383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427180313"
     variation       5384
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257105610"
     variation       5390
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980572702"
     variation       5403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482074306"
     variation       5406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251218791"
     variation       5411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204296656"
     variation       5416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339971022"
     variation       5417
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253051915"
     variation       5427..5432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gtg"
                     /replace="gtggtg"
                     /db_xref="dbSNP:1452534649"
     variation       5430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479970299"
     variation       5433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1320955821"
     variation       5435
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293465827"
     variation       5457
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176838193"
     variation       5458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:832337"
     variation       5465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1416327253"
     variation       5467
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316500201"
     variation       5468
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113789039"
     variation       5469
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431647587"
     variation       5480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378152"
     variation       5481
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457667192"
     variation       5482
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:832336"
     variation       5494
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167315959"
     variation       5495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471748514"
     variation       5497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411574216"
     variation       5502..5503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:4012117"
     variation       5503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2378154"
     variation       5504..5505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gta"
                     /db_xref="dbSNP:1558766996"
     variation       5504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1182953928"
     variation       5505..5507
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1284270790"
     variation       5505..5506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gta"
                     /replace="ta"
                     /db_xref="dbSNP:1553445879"
     variation       5505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2378155"
     variation       5506..5507
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gtat"
                     /db_xref="dbSNP:1221714822"
     variation       5506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208006163"
     variation       5509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316010105"
     variation       5510
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273617298"
     variation       5513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573533045"
     variation       5516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283195699"
     variation       5521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543978777"
     variation       5522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:539351545"
     variation       5523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266191413"
     variation       5525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762087458"
     variation       5529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337028099"
     variation       5530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490152416"
     variation       5533
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299733165"
     variation       5534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189815100"
     variation       5535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054238405"
     variation       5537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544995658"
     variation       5543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:908463105"
     variation       5548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159424201"
     variation       5549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468468375"
     variation       5552..5558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aataata"
                     /replace="aataataata"
                     /db_xref="dbSNP:1157031428"
     variation       5556
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196614906"
     variation       5557
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1453700573"
     variation       5559
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378156"
     variation       5562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378157"
     variation       5564..5567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:3085016"
     variation       5577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140657360"
     variation       5578
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182139925"
     variation       5582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304353417"
     variation       5587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558767100"
     variation       5588..5595
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tatt"
                     /replace="tatttatt"
                     /db_xref="dbSNP:776214794"
     variation       5588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253760134"
     variation       5589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1231955452"
     variation       5602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898518621"
     variation       5607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2378159"
     variation       5609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190773265"
     variation       5611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350897173"
     variation       5614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319151741"
     variation       5621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997325875"
     variation       5625..5630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttg"
                     /replace="ttgttg"
                     /db_xref="dbSNP:1400098621"
     variation       5627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172038145"
     variation       5630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914395394"
     variation       5639
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435486700"
     variation       5645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1395598235"
     variation       5648
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195436519"
     variation       5659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049812790"
     variation       5663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891268742"
     variation       5669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144306378"
     variation       5684..5689
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atgtta"
                     /db_xref="dbSNP:1223125896"
     variation       5686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008350751"
     variation       5690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199388347"
     variation       5692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348055361"
     variation       5697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283018275"
     variation       5699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269442399"
     variation       5708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031848686"
     variation       5714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180866908"
     variation       5716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1433378120"
     variation       5723
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:13082"
     variation       5731
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113711401"
     variation       5733..5736
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1377354417"
     variation       5738..5740
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1175388272"
     variation       5746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956479411"
     variation       5749
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383386485"
     variation       5750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183453099"
     variation       5753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476310149"
     variation       5755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011873219"
     variation       5757..5765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="taaa"
                     /replace="taaaataaa"
                     /db_xref="dbSNP:1164321561"
     variation       5766..5769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:769917184"
     variation       5767..5773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tctt"
                     /replace="tcttctt"
                     /db_xref="dbSNP:772571548"
     variation       5767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485675018"
     variation       5768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558767236"
     variation       5769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259044198"
     variation       5771
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569342824"
     variation       5779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408746703"
     variation       5782..5788
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ta"
                     /replace="taaagta"
                     /db_xref="dbSNP:1022362439"
     variation       5783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539501211"
     variation       5786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336742459"
     variation       5790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448451420"
     variation       5794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1802988"
     variation       5799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:967770522"
     variation       5803
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234161846"
     variation       5807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980488458"
     variation       5810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926378917"
     variation       5811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409335381"
     variation       5817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353856249"
     variation       5819
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960490963"
     variation       5821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411395436"
     variation       5834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283811252"
     variation       5835
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551848221"
     variation       5837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163711067"
     variation       5838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1246134093"
     variation       5842..5848
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="act"
                     /replace="actgact"
                     /db_xref="dbSNP:1419641321"
     variation       5848..5850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1267107620"
     variation       5849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188505728"
     variation       5851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992001387"
     variation       5853
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322871004"
     variation       5862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450190692"
     variation       5864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908413984"
     variation       5865..5866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1558767324"
     variation       5865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1558767316"
     variation       5866..5869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="cact"
                     /db_xref="dbSNP:1558767332"
     variation       5866..5867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1558767335"
     variation       5866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:11450019"
     variation       5867..5870
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:200595333"
     variation       5867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:60305801"
     variation       5867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1558767340"
     variation       5868..5871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="cttg"
                     /db_xref="dbSNP:1558767351"
     variation       5869..5878
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttgag"
                     /replace="ttgagttgag"
                     /db_xref="dbSNP:752569803"
     variation       5869..5871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:60926806"
     variation       5871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201147238"
     variation       5873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:59534639"
     variation       5874
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1458928236"
     variation       5881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223282533"
     variation       5889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533916022"
     variation       5895
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280004044"
     variation       5898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444333118"
     variation       5899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347852897"
     variation       5900..5913
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agg"
                     /replace="aggctcttgatagg"
                     /db_xref="dbSNP:1241587413"
     variation       5903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461805715"
     variation       5905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444056106"
     variation       5910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188286149"
     variation       5914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1370297350"
     variation       5915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474682068"
     variation       5921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396204325"
     variation       5922..5926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcatg"
                     /replace="gcatggcatg"
                     /db_xref="dbSNP:201005838"
     variation       5926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1401480430"
     variation       5928
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:59363501"
     variation       5929
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1038318683"
     variation       5940
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477311394"
     variation       5941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1404946841"
     variation       5945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194653203"
     variation       5946
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558767419"
     variation       5949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470157934"
     variation       5952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396276742"
     variation       5957
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215343208"
     variation       5962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317552283"
     variation       5966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555867147"
     variation       5967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286459366"
     variation       5977
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217595057"
     variation       5982
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2918774"
     variation       5983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:919892431"
     variation       5986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932685274"
     variation       5990
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324183330"
     variation       6007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372915077"
     variation       6010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537662541"
     variation       6019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452629907"
     variation       6020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556041345"
     variation       6021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534975075"
     variation       6025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891216477"
     variation       6031
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394997213"
     variation       6037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174832847"
     variation       6043
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766545530"
     variation       6044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455808437"
     variation       6045
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577767300"
     variation       6053..6056
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gtgt"
                     /replace="gtgtgt"
                     /db_xref="dbSNP:1186100682"
     variation       6059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486304490"
     variation       6063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244098121"
     variation       6064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368874000"
     variation       6068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347259111"
     variation       6069
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053216235"
     variation       6076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234967972"
     variation       6078
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349724143"
     variation       6090..6095
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="acctta"
                     /db_xref="dbSNP:1461001445"
     variation       6090
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293144253"
     variation       6091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381476416"
     variation       6096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290321861"
     variation       6102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:891988325"
     variation       6103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012232335"
     variation       6106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1437148852"
     variation       6108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258276024"
     variation       6110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12779"
     variation       6113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4012109"
     variation       6117
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180340185"
     variation       6118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968094956"
     variation       6126
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440000"
     variation       6127
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258343650"
     variation       6138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478987582"
     variation       6139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1174673989"
     variation       6143
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001872678"
     variation       6144
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486591548"
     variation       6145..6148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:1558767570"
     variation       6146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249609067"
     variation       6151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033396935"
     variation       6156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1156551322"
     variation       6158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429053594"
     variation       6160
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466179254"
     variation       6161
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1307875407"
     variation       6162
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297197760"
     variation       6166
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:832333"
     variation       6167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145909274"
     variation       6171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015829547"
     variation       6176
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416132693"
     variation       6185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573869381"
     variation       6189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298700346"
     variation       6190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342252431"
     variation       6197..6201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:974373079"
     variation       6199..6205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /replace="tgttgttgtt"
                     /db_xref="dbSNP:1221635519"
     variation       6201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61514892"
     variation       6206
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312564750"
     variation       6208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418895361"
     variation       6210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190144180"
     variation       6211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471683135"
     variation       6215
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932617954"
     variation       6217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1258049070"
     variation       6220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195165001"
     variation       6223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480815777"
     variation       6229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1252881600"
     variation       6230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2378160"
     variation       6236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187895616"
     variation       6241
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1160367982"
     variation       6243
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378161"
     variation       6252
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053162216"
     variation       6253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378162"
     variation       6254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763600564"
     variation       6255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399318714"
     variation       6257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489526919"
     variation       6258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197906673"
     variation       6259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395473598"
     variation       6260..6265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1167385436"
     variation       6265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268541692"
     variation       6275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434184395"
     variation       6285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043662482"
     variation       6286
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361747406"
     variation       6292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765562753"
     variation       6293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906124289"
     variation       6296..6307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttaattt"
                     /replace="ttaatttaattt"
                     /db_xref="dbSNP:3085045"
     variation       6296..6301
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttaatt"
                     /db_xref="dbSNP:1252631114"
     variation       6300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467914439"
     variation       6315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1273365164"
     variation       6317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361913552"
     variation       6322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378163"
     variation       6329
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378164"
     variation       6337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368029879"
     variation       6338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1338043991"
     variation       6340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896181236"
     variation       6343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440552153"
     variation       6345
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533561946"
     variation       6346
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372185386"
     variation       6350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013312701"
     variation       6360
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1015361362"
     variation       6361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384586693"
     variation       6364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558767766"
     variation       6368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2889839"
     variation       6375
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455476669"
     variation       6376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551615281"
     variation       6380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191563215"
     variation       6385
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:527697632"
     variation       6390
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253415458"
     variation       6392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183670485"
     variation       6394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985368663"
     variation       6395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912551539"
     variation       6399..6401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:944056853"
     variation       6400
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278730030"
     variation       6412..6417
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1234244930"
     variation       6419
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567228584"
     variation       6423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412906767"
     variation       6424
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429112375"
     variation       6428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326074701"
     variation       6430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913318430"
     variation       6438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542817137"
     variation       6439
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373717460"
     variation       6440
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310940403"
     variation       6442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433999304"
     variation       6448
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:561406552"
     variation       6450..6456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:1395653065"
     variation       6450
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537801720"
     variation       6452
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10195411"
     variation       6453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937562875"
     variation       6470
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193459256"
     variation       6471
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057402731"
     variation       6479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:571389758"
     variation       6484..6487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1162831721"
     variation       6484
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1209591626"
     variation       6490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013260347"
     variation       6491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459406823"
     variation       6493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213169472"
     variation       6502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527379338"
     variation       6505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189555874"
     variation       6508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270927151"
     variation       6512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558767898"
     variation       6516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229913505"
     variation       6519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192380834"
     variation       6521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572137113"
     variation       6522..6533
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttt"
                     /replace="tttttttacttt"
                     /db_xref="dbSNP:1336105260"
     variation       6522..6528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1375979398"
     variation       6527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407934661"
     variation       6530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1446232675"
     variation       6530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395543066"
     variation       6540..6543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:767944105"
     variation       6541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478586175"
     variation       6566
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185512962"
     variation       6567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186601190"
     variation       6568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554558878"
     variation       6569
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239669794"
     variation       6577..6578
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1203045993"
     variation       6580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437571917"
     variation       6581..6584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1274121705"
     variation       6581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006735460"
     variation       6583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1019510323"
     variation       6597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312139012"
     variation       6600..6602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1292964418"
     variation       6601..6607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttctctt"
                     /replace="ttctcttctctt"
                     /db_xref="dbSNP:869036614"
     variation       6602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322798110"
     variation       6606..6608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1553446197"
     variation       6608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115011524"
     variation       6609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357451513"
     variation       6613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285839246"
     variation       6614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753983574"
     variation       6615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913258888"
     variation       6616
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457654427"
     variation       6619
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754964550"
     variation       6621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391818434"
     variation       6624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163783521"
     variation       6628
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758232455"
     variation       6629
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968830163"
     variation       6632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3889416"
     variation       6636
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1239675850"
     variation       6641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927415503"
     variation       6642..6645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1470043687"
     variation       6647
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234034336"
     variation       6651
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180880221"
     variation       6652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378165"
     variation       6655..6659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1442210106"
     variation       6659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378166"
     variation       6660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378167"
     variation       6663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758153126"
     variation       6665
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182395608"
     variation       6666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413911795"
     variation       6673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558768065"
     variation       6675..6679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:1349866474"
     variation       6678..6681
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:538760382"
     variation       6680..6685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aat"
                     /replace="aataat"
                     /db_xref="dbSNP:1168234801"
     variation       6680
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371013043"
     variation       6684..6686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="att"
                     /db_xref="dbSNP:1353459075"
     variation       6684
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2099607"
     variation       6685..6690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1368525082"
     variation       6685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917510907"
     variation       6686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353703643"
     variation       6693
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351294344"
     variation       6697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563179808"
     variation       6698..6703
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1409277678"
     variation       6704..6710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttacttt"
                     /db_xref="dbSNP:1036696314"
     variation       6704..6709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttactt"
                     /db_xref="dbSNP:1160977932"
     variation       6708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252785201"
     variation       6715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753251180"
     variation       6716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332270148"
     variation       6718
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190421803"
     variation       6720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215141556"
     variation       6723
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447670874"
     variation       6724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149196384"
     variation       6727..6731
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1242269628"
     variation       6736
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345413957"
     variation       6739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143276373"
     variation       6746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219655739"
     variation       6748..6752
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1369263246"
     variation       6750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558768176"
     variation       6758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527736758"
     variation       6764..6769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="att"
                     /replace="attatt"
                     /db_xref="dbSNP:1429332630"
     variation       6765..6772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tta"
                     /replace="ttatttta"
                     /db_xref="dbSNP:1230527344"
     variation       6766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549064955"
     variation       6768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317660942"
     variation       6786..6794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atatgttta"
                     /db_xref="dbSNP:3085067"
     variation       6786..6789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1395055319"
     variation       6788
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174654695"
     variation       6793..6797
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="taact"
                     /db_xref="dbSNP:1435339289"
     variation       6793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219680181"
     variation       6797..6799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:757230621"
     variation       6798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186154754"
     variation       6800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486214690"
ORIGIN      
agaagtgcagcggtggcggcggctggttgcgggccggcggcgggctggcggagatggaggtaactcaggatcttgttcaagatggggtggcttcaccagctacccctgggaccgggaaatctaagaattggagaaagaaattgaagaactcagatcaaaacctgttactgaaggaactggtgatattattaaggcattaactgaacgtctggatgctcttcttctggaaaaagcagagactgagcaacagtgtctttctctgaaaaaggaaaatataaaaatgaagcaagaggttgaggattctgtaacaaagatgggagatgcacataaggagttggaacaatcacatataaactatgtgaaagaaattgaaaatttgaaaaatgagttgatggcagtacgttccaaatacagtgaagacaaagctaacttacaaaagcagctggaagaagcaatgaatacgcaattagaactttcagaacaacttaaatttcagaacaactctgaagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttgaggagcaaattttatatctgcaaaagcaattagacgctaccactgatgaaaagaaggaaacagttactcaactccaaaatatcattgaggctaattctcagcattaccaaaaaaatattaatagtttgcaggaagagcttttacagttgaaagctatacaccaagaagaggtgaaagagttgatgtgccagattgaagcatcagctaaggaacatgaagcagagataaataagttgaacgagctaaaagagaacttagtaaaacaatgtgaggcaagtgaaaagaacatccagaagaaatatgaatgtgagttagaaaatttaaggaaagccacctcaaatgcaaaccaagacaatcagatatgttctattctcttgcaagaaaatacatttgtagaacaagtagtaaatgaaaaagtcaaacacttagaagataccttaaaagaacttgaatctcaacacagtatcttaaaagatgaggtaacttatatgaataatcttaagttaaaacttgaaatggatgctcaacatataaaggatgagttttttcatgaacgggaagacttagagtttaaaattaatgaattattactagctaaagaagaacagggctgtgtaattgaaaaattaaaatctgagctagcaggtttaaataaacagttttgctatactgtagaacagcataacagagaagtacagagtcttaaggaacaacatcaaaaagaaatatcagaactaaatgagacatttttgtcagattcagaaaaagaaaaattaacattaatgtttgaaatacagggtcttaaggaacagtgtgaaaacctacagcaagaaaagcaagaagcaattttaaattatgagagtttacgagagattatggaaattttacaaacagaactgggggaatctgctggaaaaataagtcaagagttcgaatcaatgaagcaacagcaagcatctgatgttcatgaactgcagcagaagctcagaactgcttttactgaaaaagatgcccttctcgaaactgtgaatcgcctccagggagaaaatgaaaagttactatctcaacaagaattggtaccagaacttgaaaataccataaagaaccttcaagaaaagaatggagtatacttacttagtctcagtcaaagagataccatgttaaaagaattagaaggaaagataaattctcttactgaggaaaaagatgattttataaataaactgaaaaattcccatgaagaaatggataatttccataagaaatgtgaaagggaagaaagattgattcttgaacttgggaagaaagtagagcaaacaatccagtacaacagtgaactagaacaaaaggtaaatgaattaacaggaggactagaggagactttaaaagaaaaggatcaaaatgaccaaaaactagaaaaacttatggttcaaatgaaagttctctctgaagacaaagaagtattgtcagctgaagtgaagtctctttatgaggaaaacaataaactcagttcagaaaaaaaacagttgagtagggatttggaggtttttttgtctcaaaaagaagatgttatccttaaagaacatattactcaattagaaaagaaacttcagttaatggttgaagagcaagataatttaaataaactgcttgaaaatgagcaagttcagaagttatttgttaaaactcagttgtatggttttcttaaagaaatgggatcagaagtttcagaagacagtgaagagaaagatgttgttaatgtcctacaggcagtcggtgaatccttggcaaaaataaatgaggaaaaatgcaacctggcttttcagcgtgatgaaaaagtattagagttagaaaaagagattaagtgccttcaagaagagagtgtagttcagtgtgaagaacttaagtctttattgagagactatgagcaagagaaagttctcttaaggaaagagttagaagaaatacagtcagaaaaagaggccctgcagtctgatcttctagaaatgaagaatgctaatgaaaaaacaaggcttgaaaatcagaatcttttaattcaagttgaagaagtatctcaaacatgtagcaaaagtgaaatccataatgaaaaagaaaaatgttttataaaggaacatgaaaacctaaagccactactagaacaaaaagaattacgagataggagagcagagttgatactattaaaggattccttagcaaaatcaccttctgtaaaaaatgatcctctgtcttcagtaaaagagttggaagaaaaaatagaaaatctggaaaaagaatgcaaagaaaaggaggagaaaataaataagataaaattagttgccgtaaaggcaaagaaagaactagattccagcagaaaagagacccagactgtgaaggaagaacttgaatctcttcgatcagaaaaggaccagttatctgcttccatgagagatctcattcaaggagcagaaagctataagaatcttttattagaatatgaaaagcagtcagagcaactggatgtggaaaaagaacgtgctaataattttgagcatcgtattgaagaccttacaagacaattaagaaattcgactttgcagtgtgaaacaataaattctgataatgaagatctcctggctcgtattgagacattacagtctaatgccaaattattagaagtacagattttagaagtccagagagccaaagcaatggtagacaaagaattagaagctgaaaaacttcagaaagaacagaagataaaggaacatgccactactgtaaatgaacttgaagaacttcaggtacaacttcaaaagcaaaagaaacagcttcagaaaaccatgcaagaattagagctggttaaaaaggatgcccaacaaaccacattgatgaatatggaaatagctgattatgaacgtttgatgaaagaactaaatcaaaagttaactaataaaaacaacaagatagaagatttggagcaagaaataaaaattcaaaaacagaaacaagaaaccctacaagaagaaataacttcattacagtcttcagtacaacaatatgaagaaaaaaacaccaaaatcaagcaattgcttgtgaaaaccaaaaaggaactggcagattcaaagcaagcagaaactgatcacttaatacttcaagcatctttaaaaggtgagctggaggcaagccagcagcaagtagaagtctataaaatacagctggctgaaataacatcagagaagcacaaaatccacgagcacctgaaaacctctgcggaacagcaccagcgtacgctaagtgcataccagcagagagtgacagcactacaggaagagtgccgtgctgccaaggcagaacaagctactgtaacctctgaattcgagagctacaaagtccgagttcataatgttctaaaacaacagaaaaataaatctatgtctcaggctgaaactgagggcgctaaacaagaaagggaacatctggaaatgctgattgaccagctaaaaatcaaattacaagatagccaaaataacttacagattaatgtatctgaacttcaaacattgcagtctgaacatgatacactgctagaaaggcacaacaagatgctgcaggaaactgtgtccaaagaggcggaactccgggaaaaattgtgttcaatacagtcagagaacatgatgatgaaatctgaacatacacagactgtgagtcagctaacatcccagaacgaggtccttcgaaatagcttccgagatcaagtgcgacatttgcaggaagaacacagaaagacagtggagacattacagcagcagctctccaagatggaagcacagctcttccagcttaagaatgaaccgaccacaagaagcccagtttcctctcaacaatctttgaagaaccttcgagaaaggagaaacacagacctcccgcttctagacatgcacactgtaacccgggaagagggagaaggcatggagacaactgatacggagtctgtgtcttccgccagcacatacacacagtctttagagcagctgcttaactctcccgaaactaaacttgagcctccattatggcatgctgaatttaccaaagaagaattggttcagaagctcagttccaccacaaaaagtgcagatcacttaaacggcctgcttcgggaaacagaagcaaccaatgcaattcttatggagcaaattaagcttctcaaaagtgaaataagaagattggaaaggaatcaagagcgagagaagtctgcagctaacctggaatacttgaagaacgtcttgctgcagttcattttcttgaaaccaggtagtgaaagagagagacttcttcctgttataaatacgatgttgcagctcagccctgaagaaaagggaaaacttgctgcggttgctcaaggtgaggaagaaaatgcttcccgttcttctggatgggcatcctatcttcatagttggtctggacttcgataggttgatggaaggaatatttttattaaccaaatagaatctatttacaaaaatggttcacgtatattaccacaattcttttgtcaaaaagtgtgtatatatgtttgcatctacatatatttgtacatctatatgacagatgtattttaaaagtttcatcttgaagtaaaagtacaacagcttgaagtgttgatagcaggccacagccctctaactcatgtgatttcccatgcatgctgccagaataaaaccaccaggaatgaattcactccccacttctctggaacctcaggacccgcccatttctcggcagtactgtgaattttgaagttaaactaaattttggtaccataccaactggaatttaggctttaaaaataatgtttcaaggccaggtgtggtgattcatgcctgaaatcccactactttgggaggctgaggctggagaattgcttgaggctagtgagctgtgactcccactgcactccagctcggggaacagagcgagaccttgtctctaaaaataatagtaataaaataaaaataacgttttatgactatttattgcaaggtcagagttacagattgttataaattgttgagaaatttttgtgattagaatatgaaggaaaaagctttgttggtaaaagtgacatgttaaggggctatgaagtaaatatgctgcagttaattatgctaagttaaaatacagtttagttatttgctttaaaataaactcttctttttttctttaaagtatactatctcaaaactcattatgttgtcagagccctagagctggctagtgtaacactgactatgagtaggtgggcccacacttgagttgaggtgatttcatggtgtctttccaggctcttgatagggtgtcactgcatgcaagccatgaatctgttttgagaatcctctccattttcccaaataaaaacctatcacaacagtgactatatcactcagcattggatctaaatataaaagtggtgctttcagtgtttttggcagatagtgttccataagctttccatcagaagggattttagacaccttagaggtccgtgctacatcgtcacagttcctccgaataaccttaggtggtagtgttacttgcctttgacacctctgcatatgttttaatgactagatccaaactgtgttgttcttaaatcaaaaattggataatttgtaatatttatgtgttaatcacacagtatgctctctgaagttctcttaagccttcagtttatactcttaatttaattttctttctgagctggagaactggctttgcactttggttacacagaacattggtttccaattcagtttaactgaaatttgctgctgatatgttgagtttgttctttaaaaaatagctcatatatctcatctttcctcctgtcttagaagaacagacctaactagtgaatgtattaatgaaaatgcatctatttcagagctgacatgaagagtttagtttttttactttataaactgtgaatatgagtatgccagctgcatacgatgtaactaatcatatttaaatatatttcactttctctttgactttagaccttttgaagtctgtataaacttgttttgaaatatagtctctgcttacgaatgtcataacaaaataattttttgcatgataaaaaattactttgattacaaaaggcatattctttcatggtttctgcaatgagaggaagtgtaatgattattttaatatttctattaaatatgtttaactgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]