2024-04-20 23:15:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_006624947 2795 bp mRNA linear INV 05-NOV-2019 DEFINITION PREDICTED: Apis dorsata protein argonaute-2 (LOC102671554), transcript variant X2, mRNA. ACCESSION XM_006624947 VERSION XM_006624947.2 DBLINK BioProject: PRJNA232132 KEYWORDS RefSeq. SOURCE Apis dorsata (giant honeybee) ORGANISM Apis dorsata Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Apis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_006264283.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Nov 5, 2019 this sequence version replaced XM_006624947.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Apis dorsata Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2795 /organism="Apis dorsata" /mol_type="mRNA" /db_xref="taxon:7462" /chromosome="Unknown" /tissue_type="whole body" /country="Malaysia: Borneo, Tenom" /collection_date="Feb-2007" gene 1..2795 /gene="LOC102671554" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 ESTs, 133 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 17 samples with support for all annotated introns" /db_xref="GeneID:102671554" CDS 171..2660 /gene="LOC102671554" /codon_start=1 /product="protein argonaute-2 isoform X2" /protein_id="XP_006625010.1" /db_xref="GeneID:102671554" /translation="
MHDMYLAQIPKRTNQINKLGRNIIVETNMLKLIFAQNFQTNIIHYDVIITPDKPKFLLRTIFEEFRKKQCPKRYPAFDGKKNAYSAKILPFGDKSKEEEIKIVDVNTGKERNFKIYLNKVASLDLSWLTSLKCDLMDSEKNQKCIQALDIILRHGPAYHYTMVGRSLFQPPEPGRIVSLSNGLDLWVGVFQSVVIGSKPYLNIDVAHKGFPKSQSVIDLMKELCNVQDLTPKDIERNLVNINKFLKGLKIQYELPGQPTTKRTYRVNKLVDCPRENKFHLEDQTLYSVEKYFLQIKKYSIKYPNLPCLWVGSRNNSIYLPVELCTIIAGQVIHKEMNKIQTSKMIRETATNTQKRKEKIMNSFAKMNLNQQPTLMNEFHFSVNAEFEKVPARVLKPPKLQYKEKEVTVCKGTWKAEKFFSPCVLPKNLWTILNLDKFVHTHDLYNLHEKLLHGGKFLNMEIEEAQTPFTNLTIKTNISNIIEYFKDKKKQNILLVIVILPNLENAYSIVKQISELQIHEGIVTQCIKNQTLKKLNDSTIGNILLKINSKLNGINHIITPTNRPNCLHKPCMIIGADVTHPSPDAINIPSIAAVAASHDPNAFKYNVEIRLQSPREEIIQDLEEIMIIQLKYFYTTTRQKPQKLIFYRDGVSEGQLTQIMHKELFAIKKAIARLEKSDELKIPITFLVVQKRHHVRLFPTDVKNSDDKNFNVQAGTIVDTEITHPTHIDFYLVSHTSIQGTARPTKYRCICNENQMPENEIEQLTYYLCHMFARCTRSVSYPAPTYYAHLAAFRARALIHNIPLNIDNLQEEQRKKMTLRINKSSPMFFV"
misc_feature 402..626 /gene="LOC102671554" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 657..806 /gene="LOC102671554" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 807..1151 /gene="LOC102671554" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(960..962,1002..1004,1032..1034,1044..1046, 1098..1100,1119..1121,1125..1127) /gene="LOC102671554" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1293..2564 /gene="LOC102671554" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1686..1688,1698..1700,1740..1751,1758..1760, 1782..1784,1791..1793,1803..1805,1815..1817) /gene="LOC102671554" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1896..1898,1902..1904,2112..2114,2532..2534) /gene="LOC102671554" /note="active site" /db_xref="CDD:240015" ORIGIN
gacctaatcaacaacaacatagttcaccatcacaatcacataatcaaaggcaacagtcgaatagtcctcagcaacaagcatggagacctaatcaacaacaacaacannntaattcaccacaacaagaaactgctgttgttttaaaaaaaattgattcatttacacaaaatatgcatgatatgtatttggctcaaataccaaaacgaactaaccaaataaataaattaggtagaaatattattgtggaaacaaatatgcttaaactcatttttgcacaaaattttcaaacaaatattatacattatgatgtaatcataacaccagataaaccaaaatttttattaaggactatttttgaagaatttagaaaaaagcaatgtccaaaaagatatcctgcatttgatggcaaaaaaaatgcatatagtgcaaaaattcttccttttggtgataaaagtaaggaagaagaaataaaaattgtcgatgttaatacaggaaaagaaagaaatttcaaaatatatttaaataaagttgcatctcttgatttgtcatggttaacaagtctaaaatgtgatttgatggattctgaaaagaatcaaaaatgtatacaagcattagatattattttacgtcatggacctgcataccattatacaatggttggcagatcactttttcaaccaccagaaccaggaaggattgtatcattatcaaatggattagatttatgggttggtgtatttcaatctgttgtaattggatctaaaccatatttaaatatagatgttgcacataaaggatttcctaaaagtcaatcagttattgatttgatgaaagaactatgtaatgtacaggatttaactccaaaagatatagaacgcaatcttgttaatataaataaatttttaaagggattaaaaattcaatatgaattacctggacaacctactactaaaagaacttatcgtgtaaataaattagttgattgtccaagagaaaataaatttcatttggaagatcaaactttatattcggttgaaaaatattttttgcaaattaaaaaatattcaataaaatatcccaatctgccatgcctttgggtaggatctcggaataactcaatttatttacctgttgagttatgcacgataattgccggacaagttatacacaaagaaatgaataaaattcaaacttctaagatgattcgtgaaacagcaactaatacacaaaaacgtaaagaaaaaattatgaatagttttgctaagatgaatttaaatcagcagccaactttaatgaatgaatttcatttttctgtaaatgcagaatttgaaaaagtaccagcaagagttctaaagcctccaaaattacagtataaagaaaaagaagttactgtatgtaagggaacatggaaagcagaaaaattttttagtccttgtgttttaccaaagaatttatggactattttaaacttggataaattcgtgcatactcatgatttatataatttacatgaaaaactacttcatggtggtaagtttttgaacatggagattgaagaagcacaaactccatttacaaatttaactattaaaacaaatattagtaatattatcgaatattttaaagataaaaagaaacaaaatatactacttgtaatagtgatacttccaaatttagagaatgcatatagtattgtaaagcaaatttctgaacttcaaatacacgaaggtattgtaactcaatgtataaaaaatcaaactttaaaaaaattaaatgattcaacaattgggaatattctgttaaaaattaattcaaagcttaatggtattaatcatattattactcctactaatcgtccaaattgtctacataagccatgtatgataattggtgcagacgtgactcatccatcacctgatgctataaatataccctcaattgcagctgtagcagcaagtcacgatccaaatgcttttaagtataatgttgaaataagacttcaatcaccgagagaagaaataattcaagatttggaagaaattatgatcattcaattgaaatacttttatacaacaacgagacaaaaacctcagaaattaattttttatcgagatggagtaagcgaaggacaacttacacaaataatgcataaagaattatttgcaataaaaaaagctattgcacgtttagagaaatctgatgaattaaaaatcccaatcacatttcttgtagttcaaaaacgacatcatgtacgtctttttccaactgatgtgaagaattctgatgataaaaattttaatgtacaagcagggactattgttgatactgaaattacacatccaactcatatagatttttatcttgtatctcatactagcatacaaggtactgctaggcctacaaaatatagatgtatatgcaatgaaaatcaaatgcctgaaaatgaaattgaacaacttacatattatctttgtcatatgtttgcacgttgtacaagatctgttagttatcctgcgcctacatattatgctcatttagctgcttttagagcaagagcattaatacacaatattccattgaatatagataatctgcaagaggaacagcggaaaaaaatgaccttaagaataaataaaagttcacctatgttttttgtataaaataaatgtattattttaatatataacatgtaatatgtaatatgtaatatttttgaattttttgattgctattgatttataatagtattatataacatttttttttcaaatataataaaaaatgtttataatgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]