GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 10:25:18, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_006256375            6603 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus GRIP and coiled-coil domain containing
            2 (Gcc2), transcript variant X1, mRNA.
ACCESSION   XM_006256375
VERSION     XM_006256375.4
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051355.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 21, 2021 this sequence version replaced XM_006256375.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6603
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="20"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..6603
                     /gene="Gcc2"
                     /note="GRIP and coiled-coil domain containing 2; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 5 mRNAs, 32 ESTs, 1 long SRA read, 3 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 148 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:309798"
                     /db_xref="RGD:1305732"
     CDS             134..5179
                     /gene="Gcc2"
                     /codon_start=1
                     /product="GRIP and coiled-coil domain-containing protein 2
                     isoform X1"
                     /protein_id="XP_006256437.1"
                     /db_xref="GeneID:309798"
                     /db_xref="RGD:1305732"
                     /translation="
MEVTDSAQDAVTAAPSGTPKSKLETLPREDLIKFAKKQMMLLQKAKARCTELDKEVEELKSKPVDGGTDDMIKVLTERLDALLLEKAETEQQCLCLKKENIKMKQEVEDSVTKLEETQKEFEQSHRNYVREMESVKNELIAVHSEHSKEKAALQRDLEGAVHRQAELLEQLKSQSDSEDNVKKLQEEIQNITAAFEEQTSCLQKQLEATSDEKQQEIIHLQKVIEDNAQHYQKDINTFQEEIVQLRATHKEEVNELMSQMETLAKEHEAAVNKLKENRVTLCETSETIPENYQCESESLNEDTSDASQENQKCSVALQEDPFAEHTVYDKVRQLEDSLKELESQHSILKDEVTYMNNLKLKLEMDAQHIKDEFFHEREDLEFKINELLLAKEEQSYVVEKLKYEREDLNRQLCCTVEQHNKEIQRLQEHHQKEISELSETFMSGSEKEKLALMFEIQGLKEQCENLQHEKQEVVLNYESLREMMEILQTELGESAGKISQEFETMKQQQASDVHELQQKLRTAFNEKDALLETINRLQGENEKLLSQELVSELESTMKNLKADNSMYLASLGQKDTLLQELEAKISSLAEEKDDFISKIKTSREEIDDLHQKWEREQKLSVELREAAEQAAQHNSELRQRVSELTGKLDEILREKSQNDQNIMVQMKTMTEDQEALSSKIKSLYEENNRLHSEKVQLSRDLEALQSQQDFAYKEHVAEFEKKLQLMVEERDDLNKLLENEQLQKSFVKTQLYEFLKQMRPSILEDNEEEDVVTVLKAVGESLVTVKEEKHNLVFEYDARVLELERRIKCLQEESVVQCEELRALVRDSEQEKILLRKELDEVTSTKEALQCDILEMKNTNEKTSLENQTLSTRVEELSRSLHSKNEVHNEKDLVIEHENLRLSLEQRESELQDVRAELMLLKDSLEKSPSVKNDQLSLVKELEEKIESLEKESKDKDEKISKIKLVAVRAKKELDSNRKEAQTLRDELESVQSEKDRLSASMKEFIQGAESYKNLLLEYDKQSEQLDVEKERANNFEHHIEDLTKQLRDSTCQYEKLTSDNEDLLARIETLQANARLLEAQILEVQRAKGVVEKELEAEKLQKEQKIKEHVSTTNELEELQLQFQKEKKQLQKTMQELELVKKDAQQTTLMNMEIADYERLMKELNQKLTNKNSKIEDLEQEMKIQKQKQETLQEEMTSLQSSVQHYEEKNAQIKQLLVKTKKELADAKQAETDHLLLQASLKGELEASQQQVEVYKIQLAEMTSEKHKIHEHLKTSAEQHQRTLSAYQQRVVALQEESRTAKAEQAAVTSEFENYKVRVHNVLKQQKNKSVSQAETEGAKQEREHLEMLIDQLKIKLQDSQNSLQISVSEFQTLQSEHDTLLERHNRMLQETVTKEAELREKLCSAQSENTMLKSEHAQTMCQLTSQNEALRNSFRDQVRHLQDEHRKTVETLQHQLSKVETQLFQLKSEPPTKSPASSHQPSKSLRERRTTDLPLLDMHTVTREEGEGMETTDSESVSSAGTHIQSLEQLLSSPDSKLERLTEASLWHTEFTKEELAEKLSSTTKSADHLNGLLRETEATNAILMEQIKLLKSEIRRLERNQEREKSVANLEYLKNVLLRFIFLKPGSERERLLPVIDTMLQLSPEEKGKLATVAQGEEESASRSSGWASYLHSWSGLR"
     misc_feature    215..2629
                     /gene="Gcc2"
                     /note="chromosome segregation protein SMC, primarily
                     archaeal type; Region: SMC_prok_A; TIGR02169"
                     /db_xref="CDD:274009"
     misc_feature    455..>748
                     /gene="Gcc2"
                     /note="TMPIT-like protein; Region: TMPIT; pfam07851"
                     /db_xref="CDD:285135"
     misc_feature    <1523..3868
                     /gene="Gcc2"
                     /note="Chromosome segregation ATPase [Cell cycle control,
                     cell division, chromosome partitioning]; Region: Smc;
                     COG1196"
                     /db_xref="CDD:224117"
     misc_feature    2843..5032
                     /gene="Gcc2"
                     /note="Chromosome segregation ATPase [Cell cycle control,
                     cell division, chromosome partitioning]; Region: Smc;
                     COG1196"
                     /db_xref="CDD:224117"
     misc_feature    4766..4960
                     /gene="Gcc2"
                     /note="Rab binding domain; Region: Rab_bind; pfam16704"
                     /db_xref="CDD:293309"
     misc_feature    4964..5092
                     /gene="Gcc2"
                     /note="GRIP domain; Region: GRIP; pfam01465"
                     /db_xref="CDD:279767"
ORIGIN      
tctgcgtagccttggagacgcgggggaggcgtagtcgcctcgttgcaagacctttgacccgcgctccgccgcctcagaggcggagtacctaggacgcctgaaaaggccgaggtggccgcgggtcgctgccacgatggaggtaacggattctgctcaagatgctgtgactgcagcaccctccgggaccccgaaatccaagctagaaacattgcccagagaagatctcatcaagtttgccaagaagcagatgatgctcctacagaaagccaaagcaaggtgtacagaattagacaaagaagttgaagagctcaaatcaaaacctgttgacggaggaactgatgatatgattaaggtgctaactgaacgcttggatgctcttcttctggaaaaagcagagactgaacaacagtgtctgtgtctcaaaaaagaaaatattaaaatgaagcaagaggttgaggattctgtaactaaactggaagagacacaaaaagagtttgaacaatcacatagaaactacgtaagagaaatggaaagtgttaaaaatgaactgatagcagtacactcagagcacagcaaagaaaaggctgccttacaaagagacctggagggagcagtccataggcaagcagagctgttagaacagctcaagtctcagagcgactctgaagataatgttaaaaaactacaggaagagattcagaacattacagcagcatttgaggaacaaacgtcatgtctacaaaagcaattagaagctaccagtgatgaaaaacagcaagagattattcatctccagaaagtcattgaggacaacgctcagcactaccaaaaagatattaatactttccaagaagagattgtgcagctgagagctacacacaaagaagaagttaatgagctgatgtctcaaatggaaacattagctaaagaacatgaggcagcagtaaataagctaaaagagaacagagtgacactgtgtgagacaagtgagaccattccagagaattaccaatgtgaatcagaaagcttaaatgaagacacctcagatgcaagccaggagaatcaaaaatgctctgtggccttacaggaagatccttttgcagaacatacagtgtatgataaagtcagacaattggaagattcattaaaagaactggaatctcaacatagtatcttaaaagatgaagtgacttatatgaataatctcaagttaaaacttgaaatggatgcccagcatataaaggatgagtttttccatgaaagagaagacttggagtttaaaattaatgaactgttgctggccaaagaagaacagagctacgtagtagaaaaattaaaatatgagcgagaagatttaaataggcagctttgctgtactgtggaacaacataacaaagaaatacagcgtcttcaggagcaccatcagaaagaaatctctgaactaagtgagacatttatgtcaggttcagaaaaagaaaagttagcattaatgtttgaaatacagggacttaaggaacagtgtgaaaatctacaacatgaaaagcaagaggtagttctaaattatgagagtttacgagagatgatggaaattttacaaacggaacttggagaatctgctggaaaaataagtcaagagtttgaaacaatgaagcaacagcaagcatctgatgttcatgagcttcagcagaagctaagaactgcttttaacgaaaaagacgctcttcttgaaactataaatcgcctacaaggagaaaatgaaaaattattatcacaagaattggtatcagaactcgaaagtaccatgaagaaccttaaggcagataatagcatgtacttagccagccttggtcaaaaagataccctgttacaagaattagaagcaaagataagttctcttgctgaagaaaaagatgattttataagtaaaatcaaaacttcccgtgaagagatagatgatctccatcagaaatgggaaagggaacagaaactgtctgtagaactcagggaagcagcagagcaagccgcccagcacaacagtgaactgagacaaagagtaagtgaattaacaggaaaactagatgaaatattaagagaaaagagtcaaaatgaccaaaacattatggttcaaatgaaaaccatgacagaagaccaagaagcattgtcatctaaaatcaagtctctttatgaggaaaacaatagactgcattctgaaaaggtccagttgagtagagatttagaagctcttcagtctcaacaagattttgcctataaagagcatgttgctgaattcgaaaagaaactccagttaatggttgaagaacgagatgatttaaataaactgcttgaaaatgagcaacttcagaagtcatttgtcaaaactcagttgtacgagtttcttaagcaaatgaggccaagcattttagaagataatgaagaggaagatgttgtcacagttctaaaagctgtgggtgaatccttagtgacagtaaaggaagaaaagcataacttagtctttgaatatgatgcgagagtattagaattagaaaggaggattaagtgccttcaagaggagagtgtagttcagtgtgaagaactaagggctttagtaagagactctgaacaagagaaaattctcctaagaaaagaattagatgaagtcacatcaacaaaagaggccctgcagtgtgatattctagaaatgaagaatactaatgaaaaaacaagccttgaaaatcagactctttcaactcgggttgaagaattatcgcggtcattacacagcaaaaatgaagtccataatgaaaaggatcttgtcatagaacatgaaaacctgaggctatcgcttgagcagagggagtctgagctacaagatgtgagagcagaattgatgctgctgaaggattccttagagaaatcgccttctgtaaaaaatgatcaactttcattggtaaaagagctggaagaaaaaatagaaagtctggaaaaagaatccaaagacaaggatgagaaaatcagtaagataaaactagtcgctgtgagagcaaagaaagaactagattctaacaggaaagaggcccagacactacgggacgaactcgagtccgtacagtcagaaaaggaccgcttatctgcttctatgaaggagtttatccaaggagcagaaagctataagaatcttctgttagaatatgacaagcagtcagaacagctggatgtggaaaaagaacgtgctaataattttgaacatcacatagaagaccttaccaaacaattaagagattcgacttgccagtatgaaaaactaacttccgacaatgaggatctcctggctcgaattgagaccctgcaggctaatgccaggttattagaagcacagatcttagaggtccagagagccaaaggagtagtagaaaaagaactggaagctgaaaaacttcagaaagagcagaaaattaaggaacatgtcagtactacaaatgagcttgaagaacttcaactccaatttcaaaaggaaaagaagcagcttcagaaaacgatgcaagaattagaactggttaaaaaggatgcccaacagaccacgttgatgaatatggaaatagcagattacgaacgtttgatgaaagaattaaatcaaaagttaacaaataaaaacagtaagatagaagatttggagcaagaaatgaaaattcagaaacagaaacaagaaaccctacaagaagaaatgacttccctgcagtcttcagtacagcactacgaagaaaagaacgcccaaatcaagcagctgcttgtgaaaaccaaaaaggaactggcagatgcaaagcaagcagaaactgatcacttactactccaggcgtctttaaagggcgagctggaagcaagccagcagcaagtagaagtctataaaattcagctagctgagatgacatctgagaaacacaaaatccatgagcacctgaagacttctgcggaacagcaccagcgcacactaagtgcataccagcagagggtggtggccctgcaggaagagagccgcactgccaaggcagagcaagctgctgtcacctctgaatttgagaactacaaagtccgggttcataacgttctaaaacaacagaaaaataaatctgtgtctcaggctgaaactgagggagctaaacaagaaagggaacacctggaaatgctgattgaccaactgaaaatcaagttacaggacagccaaaacagcttacaaatcagtgtgtcagagttccagacactgcagtctgagcatgacactctgctagagaggcacaaccggatgctgcaggaaactgtgaccaaagaggcggaacttcgggaaaagttatgttcagctcaatctgagaacaccatgttgaagtctgaacacgcccagacaatgtgtcagctgacatcccagaatgaggccctccgtaacagcttccgagaccaagttcgacacttgcaggatgagcacagaaagacagtggagaccttgcagcaccagctctccaaggtggaaactcagctcttccagctcaagagtgagccacccacaaaaagccctgcttcttcccatcaaccttcaaaaagcctccgagaaagacggaccacagacctcccccttctggacatgcacactgtgacccgagaggagggggaagggatggagacaactgacagtgagtctgtgtcttcggccggcacacacattcagtccttggagcagctccttagctctcctgacagcaagcttgaacgtcttacagaggcctccttatggcatacagaatttaccaaagaagaattggctgagaagctcagttccaccacgaagagtgcagatcacttaaatggcctgcttcgggagacagaggctaccaacgccatccttatggagcaaattaagcttctcaaaagtgaaataagaagactggaaagaaaccaagagcgggagaagtctgtggctaacctggagtacttgaagaatgtcctactgcggttcattttcctgaagccgggtagtgaaagagagaggcttcttcctgtgatagacacgatgctgcagctcagccctgaagaaaagggaaagcttgccacagttgctcaaggtgaggaagaaagtgcctctcgttcctctggatgggcatcctaccttcatagctggtctggactgcgataggttgacagaaagaagattctttagtgatgcaacagaactcctttggaaaagctgggtatcatttgatcatgaagtgtgcatctctgttcacatcccctgatgattgtacatatgtatagcccatgtatatagaatctcatcttgtagtaaaaggacatcagcttgaagtagtggtaccaattgttcatggtcctctaactcagcatgtggcctcatggtctctgtgatctccacccacagaggaaacggttcattcctgcactctggaaccccaggagacactcatttctaagtagtattgtgaattttgatattgaactaaattttggtaccaaaccaactggggaatttaatcttttaaaataatgtttcaagattgaggaaatgctttattgataaggttgacatgtttattaaaagattatgaagtaaatatgctatggtttaattatgaggctaacttaaattgcaattcagtcagttactttaaaataaacctccctcccatttgtaattttcaaaattggccctagtcctggtaatgtgacactgacagaataggtgggctccacctcagctgatgtgttctgtggtgtctccaggcttgtttgctgccactcataagccatgagtctcttttgagaattccctacatctcaaaacagtgactgtcttactcagcattaaatctacatgtgaacctggtgcttccagtattgttcaagtattcttatttcctaagcaggaccccagagggctcagaccctctattggtgaacaagcctagctgggggagtgtctctgtccttatgtctctggaaatactatattgactagattaaaattgtgctcttaaatcagatttgggggttatattttaatatgtaatttgttaatgaatagtgctgtctggagtcttaagcttacgtttattctccagttgtcagtctcagcttgaaactgtcctttagtcactatgaatattggtttccaacctggtttgactgaaatttactgctgacatgttgagtttgttctcttaaagctgtttgactctcagtgttcgctctacctgtgttagaacagacctagcaagtgagtgtgctgattcaaacacatctctctcagctgactctttaaggtaaggttttctacctttataaactgtgaatgtgagtatgcccagcggaatcccatgtaatttcagtactatttaaataaactccatgttttctttgggcctaatatgccttttgaagtctgtataaacttgttttcaaatctaatctgttcatatgaatataataaaaataccttttgcatggtaaaaattactttgattacaaaagatatatatatgctttttgtgaccagcaataagaaactgtaatgactgatatttctattaaatgcacttaactata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]