GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 14:28:49, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       XM_006249502            3732 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus spliceosome associated factor 3, U4/U6
            recycling protein (Sart3), transcript variant X3, mRNA.
ACCESSION   XM_006249502
VERSION     XM_006249502.4
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051347.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 21, 2021 this sequence version replaced XM_006249502.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3732
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="12"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..3732
                     /gene="Sart3"
                     /note="spliceosome associated factor 3, U4/U6 recycling
                     protein; Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 35 ESTs, 3 long SRA reads, 1
                     Protein, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 46 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:304582"
                     /db_xref="RGD:1311646"
     CDS             480..3023
                     /gene="Sart3"
                     /codon_start=1
                     /product="squamous cell carcinoma antigen recognized by
                     T-cells 3 isoform X3"
                     /protein_id="XP_006249564.1"
                     /db_xref="GeneID:304582"
                     /db_xref="RGD:1311646"
                     /translation="
MARQKMSEIFPLTEELWLEWLHDEISMAVDGLDRERVYELFERAVKDYICPNIWLEYGQYSVGGIGQKGGLEKVRSVFERALSSVGLHMTKGLAIWEAYREFESAIVEAARPIAAFLSPSDREQTFDSQLERVHSLFRRQLAIPLYEMEATFAEYEEWSEEPIPESVLQSYQKALGQLEKYKPYEEALLQAEAPRLAEYQAYIDFEMKVGDPARIQLIFERALVENCLVPDLWIRYSQYLDRQLKVKDLVLSVHSRAVRNCPWTVALWSRYLLAMERHGLDHQMISATFENALSAGFIQATDYVEIWQVYLDYLRRRVDFRQDSSKELEELRSMFTRALEYLQQEVEERFSESGDPSCLIMQSWARVEARLCNNMQKARELWDSIMTRGNAKYANMWLEYYNLERAHGDTQHCRKALHRAVQCTSDYPEHVCEVLLTMERTEGTLEDWDLAIQKTETRLARVNEQRMKAAEKEAALVQQEEEKAEQRKKVRAEKKALKKKKTRGADKRKAGEDDDERECGEEEEEQPSKRRRMENSLASGVASAKEEETKLSGKCLTIDVAPPSKQKEKAASLKRDMPKVAHDSSKDSVTVFVSNLPYSIEEPEVKLRPLFEACGEVVQIRPIFSNRGDFRGYCYVEFKEEKSAQQALDLDRKNVEGRPMFVSPCVDKSKNPDFKMFRYSTTLEKHKLFISGLPFSCTKEELEGICKAHGTVKDLRLVTNRAGKPKGLAYVEYENESQASQAVLKMDGMTIKENVIKVAISNPPQRKVPEKPEVRTAPGAPMVPRQMYGARGKGRTQLSLLPRALQRQGAAPQAENGPAPGLAATTSVATEAPKMSNADFAKLLLRK"
     misc_feature    489..>1517
                     /gene="Sart3"
                     /note="Pre-mRNA 3'-end processing (cleavage and
                     polyadenylation) factor [RNA processing and modification];
                     Region: RNA14; COG5107"
                     /db_xref="CDD:227438"
     misc_feature    1134..>1595
                     /gene="Sart3"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
     misc_feature    2247..2468
                     /gene="Sart3"
                     /note="RNA recognition motif 1 in squamous cell carcinoma
                     antigen recognized by T-cells 3 (SART3) and similar
                     proteins; Region: RRM1_SART3; cd12391"
                     /db_xref="CDD:240837"
     misc_feature    2529..2771
                     /gene="Sart3"
                     /note="RNA recognition motif 2 in squamous cell carcinoma
                     antigen recognized by T-cells 3 (SART3) and similar
                     proteins; Region: RRM2_SART3; cd12392"
                     /db_xref="CDD:240838"
     misc_feature    2763..2939
                     /gene="Sart3"
                     /note="LSM-interacting associated unstructured; Region:
                     LSM_int_assoc; pfam16605"
                     /db_xref="CDD:293211"
     misc_feature    2964..3017
                     /gene="Sart3"
                     /note="Lsm interaction motif; Region: Lsm_interact;
                     pfam05391"
                     /db_xref="CDD:283133"
ORIGIN      
aggtgtgagcgagagcgatggggatgaggaggacgccgccatggcttcctccgccgagagctccgccggggaggacgagtgggagtacgacgaggaggaggagaagaaccagttggagatcgagcggctggaggagcagtgcctcctgttgggcaaacccagctgtaaaccattgtgccagaagaccaaaatctagtgcaccccagttgttcatgggacaaggagaagatatggaggagtgggaccaaaaagatgaagcctgttctcgtgaggaaacgaggctcagcaaatggtaggatctgactcggctgaattcacacaagtgggccttgatctcttatggtcatctgtggtccagatacccccctggaggtgcggtccctcagtgatttgtgctgtccatcaatggctatgattacaactgccacgtgggactcatcaggctgttgcggctggaaggcgagctcaacaaagtgaggatggcccgacagaagatgagcgagatcttccccttgactgaagagctctggctggagtggctccacgatgagatcagcatggctgtggacggcctggaccgcgagcgtgtctacgagctctttgagagagccgtgaaggactacatctgtccgaacatttggctagaatatggccagtactcagttggtggcattggtcagaaaggtggcctagagaaagttcgctctgtgtttgaacgagccctgtcatctgttggcctacacatgacaaaaggtctggccatctgggaggcctaccgggagtttgaaagtgccattgtggaagctgctcggcccatagctgccttcctttccccttctgaccgggaacaaacctttgattcacagctggagagagtgcacagcctcttccggcggcagctggcgatcccactgtacgagatggaggccacctttgcagagtatgaagaatggtcagaagagcccatacctgagtccgtacttcagagctatcagaaggcactggggcagctggagaagtacaagccttacgaggaagcactgttgcaagcagaggctccacggctggcggagtaccaagcttacatcgactttgagatgaaagttggggatcctgctcgcattcagttgatctttgagcgtgccctggtggagaactgcctggtgccagacttatggatccgctacagtcagtacctagatcgacagctgaaagtaaaggatttggttttatctgtacacagccgagctgtgaggaactgcccatggacagttgccctgtggagtcggtacctcctggccatggagcgacacggactggaccatcaaatgatttccgcgaccttcgagaatgctctgagtgccggattcatccaggccactgattatgtggagatctggcaggtgtacctagactacctgaggagaagggttgacttcagacaagactctagcaaagagctggaagagctgcggtccatgttcacgcgtgctctggagtatctgcagcaggaggttgaggagcgtttcagcgagagcggagatccaagctgcctgatcatgcagagctgggcccgggttgaggctcgcctgtgcaataacatgcagaaagctcgagaactctgggacagcatcatgaccagagggaatgccaagtacgccaacatgtggctggagtactacaacctggaaagggcacacggtgacacacagcactgtcggaaggctctgcaccgagctgtgcagtgcacgagcgactaccctgagcatgtctgtgaagtgctgctcaccatggagaggacagaagggaccttggaagattgggacctagccattcagaagacagagacgcgcttggctcgtgtgaacgagcaaaggatgaaggctgcagagaaggaagcagctcttgtgcagcaggaagaagaaaaggctgagcagcggaagaaggtgcgggcggagaagaaagccctgaaaaagaagaagacgcgaggtgcagacaagcgcaaggcaggcgaggacgatgatgagagagagtgcggtgaagaggaggaagaacagccttccaaacgcagaaggatggagaacagcttggcctctggagtggcttcagctaaggaggaagaaacaaaactttccgggaaatgcttaacaatagacgttgctcctccttccaagcagaaagagaaggccgcctcccttaagcgggacatgcccaaggtggctcacgacagcagcaaggacagtgtcactgtctttgtcagcaacctgccctacagcatagaagaaccagaggtgaagctcaggccgctctttgaggcctgtggggaagtggtccagatcaggccaatcttcagcaaccgtggggacttccggggctactgctatgtggagtttaaagaggagaagtcagcccagcaggccctggatctagacaggaagaatgtggaaggaaggccgatgtttgtgtccccctgtgtggataagagcaagaaccccgattttaagatgttcagatacagcaccaccctggagaaacacaaactcttcatctcgggcctgcccttttcctgcaccaaagaggaacttgaaggcatttgtaaggctcatggcactgttaaggacctcaggctggttactaacagggccggcaagccaaagggcttggcgtacgtggagtatgagaatgagtcccaggcctctcaggcagtgctgaagatggatggcatgaccatcaaagagaacgtcatcaaagtggcgatcagcaacccccctcagcggaaagttccagagaagccagaagtgaggacagccccaggagcccccatggttccccggcagatgtatggagcgcgcgggaagggacggacccagctctcgcttcttcctcgggctctgcagcgccagggtgctgctcctcaggctgagaacggcccagctccggggctggcagccaccacctctgtggccactgaggctcctaagatgtccaatgccgattttgcgaagttactcctgagaaagtgagcaggactctgagatggaatgccttacctgctccttcatgctggccaggctggctgctgtgggccctgggcacagaagggctgggcactcaaacctgcgtgcccaccgatttctcctccggtgtagatgggaagggagagcctatgttgagcatggcggtgaggagtgttccctcacattgagggcggaggccgactgctctacgggctgtcccacggtacgttagtgtcctaacaaggagggactcagctttcgaggcctacttgtcctgatactttcaccgcctctggccctttttctacgaaccccctccccggccctgcacagcacgcgtgcccatcactctttagtgtgaaaggtggagtggaggagccgcactcatcagagtggcctgttcagtgaagtgcccgagggacatcacagaaggctcgcttgatgggttttgtccaaagagcctatgagtttttctattatgtatttgtaattgacattttgactgttttatgttccctaaacgtggggagtctgcaacacttgttcctaggaattgtgtgtgccacccgctgtgtgtgccacccactgtggcccattttctttgcctgatgactgaagacctacgccctctgctcaaacactcatgcctggtgccgtgtccagtgcagagtgagttcccatttagttctgtttattaaactgaagttcttacaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]