GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2018-10-20 20:23:37, GGRNA.v2 : RefSeq release 90 (Sep, 2018)

LOCUS       XM_006238756            3442 bp    mRNA    linear   ROD 26-JUL-2016
DEFINITION  PREDICTED: Rattus norvegicus claudin 19 (Cldn19), transcript
            variant X1, mRNA.
ACCESSION   XM_006238756
VERSION     XM_006238756.3
DBLINK      BioProject: PRJNA12455
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_005104.4) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 26, 2016 this sequence version replaced XM_006238756.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Rattus norvegicus Annotation Release
                                           106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3442
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="mixed"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /sex="pooled males and females"
                     /note="pooled female animals of strain BN/SsNHsdMCW plus
                     one male of strain SHR (also known as SHR-Akr)"
     gene            1..3442
                     /gene="Cldn19"
                     /gene_synonym="claudin-19"
                     /note="claudin 19; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 1 mRNA, 31 ESTs, 12
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 30 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:298487"
                     /db_xref="RGD:1305000"
     CDS             278..952
                     /gene="Cldn19"
                     /gene_synonym="claudin-19"
                     /codon_start=1
                     /product="claudin-19 isoform X1"
                     /protein_id="XP_006238818.1"
                     /db_xref="GeneID:298487"
                     /db_xref="RGD:1305000"
                     /translation="
MANSGLQLLGYFLALGGWVGIIASTALPQWKQSSYAGDAIITAVGLYEGLWMSCASQSTGQVQCKLYDSLLALDGHIQSARALMVVAVLLGFVAMVLSVVGMKCTRVGDSNPTAKGRVAISGGALFLLAGLCTLTAVSWYATLVTQEFFNPSTPVNARYEFGPALFVGWASAGLAILGGSFLCCTCPEPERANSIPQPYRSGPSTAAREPVVKLSTSVKGPLGV"
     misc_feature    287..823
                     /gene="Cldn19"
                     /gene_synonym="claudin-19"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:304458"
ORIGIN      
gttccgccctctgctcccaagaaactgggcaagagctctgctggggactggctgtgggcgggttttggccttttccagccccaaggccgccccctgcattctggaatccagcagccactgcctttgctgagctgaccggccagccatcccctctcctcctcttttcctgtgccacttagttccccttttccagctgttcctcttaccatgaccatagcgctcctccagaccctggcccatctctgagtcctggaaccctcagactcctacctgggccatggccaactcaggcctccagctcctgggctacttcctagccttgggtggctgggtgggcatcatcgccagcaccgccctgccacagtggaagcagtcctcctatgcaggcgatgccatcatcactgccgtgggcctctacgaagggctgtggatgtcctgcgcctctcagagcaccgggcaggtgcaatgcaaactctacgattcactcctggccctggacggtcatatccagtcagcaagagccctgatggtggtggctgtgctcctgggctttgtggccatggtgctcagtgtcgtgggcatgaagtgtactcgggttggagacagtaaccccactgccaagggccgtgtggccatctccggaggtgctctcttcctcttggcgggtctctgtactttgactgctgtctcatggtacgctaccctggtgacccaggaattcttcaaccccagcactcctgtcaacgccaggtatgaatttggtccagctctgttcgtcggctgggcctctgctgggctggccatcctgggcggttcctttctctgctgcacatgcccagagcctgagagagccaacagcatcccgcagccctatcgctctggaccctcaacggctgcccgagaacccgttgttaagttgtccacctcggtcaagggccccctgggtgtgtaaaggccaggttcccagccaggccctgccccctaccatctctagactgtgtgtttgatatttctggaaagagaagcgaacattcagccccaagtgtgatgtcatgctatctgttcccatgcgcctagggtggggcctggactagagaggccagagccagctcttggggtgaggtgggctccagggtacaggcagagcaggaagcagttagtttcctgctttgtatctctgcccgccccaccttggagtctggtaccagaacttccatgagggaagatcacagctacccctggaggcgtcacctaacgcctgcctggcctaataaaggagcaagacctcagggtgaggaagccctggcacggagaccattccataggtagaatgttctaggccctccctgggagccctcctgagggaaaagatagtttctgtgaggcccaaccgtaggggctcccttggtgatggaagggaatggagaggagcatggatggtatcaggacaaccccaagccaactccaaagccctccatgcaactgttatcctactcctgcaatgactgtcaacgctccctcaccctgaagtgtagtcagatgacaggacttctggtcttgaaatccaggtatgacgtactagaaaaggttaagtccttcaaggcgctgagagaaaccagcccagggaagcaaagggccagcagtgtccttcatcctccctatccagagagtgccggcccctctcttcactcataggcttctgccacccaagcctctccctggactccaggtctgtccctctccagggacgaggtgtccaccactctcgtcttgcttcccacatgccttccttgttagcccgctggtgtctacaaccgcgtctcccaccaagtgaaccccaggagccagtacagcttctgtgcagccctgaggtgcggataccaaaacattatagctgacggtggggagggcggggggaaagcaggtgaccaagcgcttctgtgctcaggtaatcacatacctgatgaactgctgaccaattcatcttctgacggatggtagccataagcccccgtggacacctctgatcctaaacaagtttcccaagggaggccccttgcaccataagtgccacagaagagctctctccaagtgcccaaagccatccggtgatccttggccttaggaccacactggagtcatttaagtggatgcccagcctccacccagacacaatgatttaattggtctagtggacccaggcttcagaattcacacagctccttcgaagtatgtggttcatctaggggtaactccttgaggcccacactcctgaccattctggagggatctgcagagggtggaaggagcctaccagaagacagtgggggagaggcaagactagaaaggaagtcctgtccacctcctgcctttccggagtcctgaccactggaggagacgcctatatccttcccattgatgtctctttgtgcttaaggaattcaactttgaatcctgtcacttgcagcctgactaactcagagcttgaaacctgtgaaccaagtgggacacagacagaccctccacagatctggtacttagcagcccttggtatttggttgtgaagctggcaggaagccacatgattcttcagagtccgagggctgggcggttcaagacatggtggtggggatcgtagaggcagaatgtgttggctacatcttgtggttgtcaggagtgggctccatgcaaggacaggagctgacagtggggtggcattgtctgttcctctattaaaggaagctcattctagccatacatactggagcctggaagggcagagtcatccacctttgatatttacatttgatccacatttgatatttacaccctgattaaaacccgcgaggtactgggggtgggaagggagagtgtgggagaaattgaaggagttttaagctaagagtttggggaatgtgatctcctgaagcaaacccattcaaacatccaagtctgttgtttactgttctaatctcaaggctgaaggatccaggaaagactggggaagatgaggctgactcaaaagggatggttctaaagttactgccgttgctttagtcccagaagtgaaactggcaagttagacattttgattccagaaggatggtagctccgtgttcctgaagttccaggtcctggggaaacagaccaggaagctgcaggctgggaagaagcttgaagatcattatggctggggcagtttcaagaagttgttacttttgtgttacataacactgttgctttgtgtgataatgacgctgatccttatctggcagaggtacgcctggaagcatgatggctggatttactttaactttttaaaacaggttcacaggcaaggagagctgtgatgctgggacgagccagcggctgacagggttcactctacccatttgtatgtttgctaatgaaagaaaaataagaaataaaaagtttgaaacga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]