2024-05-20 09:43:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_005853019 438 bp mRNA linear MAM 04-NOV-2015 DEFINITION PREDICTED: Myotis brandtii sodium/potassium-transporting ATPase subunit alpha-3-like (LOC102260737), partial mRNA. ACCESSION XM_005853019 VERSION XM_005853019.1 DBLINK BioProject: PRJNA218631 KEYWORDS RefSeq. SOURCE Myotis brandtii (Brandt's bat) ORGANISM Myotis brandtii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera; Vespertilionidae; Myotis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_005326159.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Myotis brandtii Annotation Release 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..438 /organism="Myotis brandtii" /mol_type="mRNA" /db_xref="taxon:109478" /chromosome="Unknown" /sex="male" /country="Russia: Perm poKrai" /lat_lon="58.8348 N 57.6119 E" /collection_date="Dec-2011" /note="collected at hibernation roost" gene <1..>438 /gene="LOC102260737" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 30% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:102260737" CDS <1..>438 /gene="LOC102260737" /codon_start=1 /product="sodium/potassium-transporting ATPase subunit alpha-3-like" /protein_id="XP_005853081.1" /db_xref="GeneID:102260737" /translation="
VIMVTGDHPITAKAIAKGVGIISEGNETEEDIADRLKIPVDQVNSRDAKAIVVHGSKLKDLNSEQLDYILQNHTEIVFARTSPQQKLIIVEGCQRLGAIVAVTGDGVNDSPALKKADIGIAMGISGSDVSKQAADMILLDDNFASI"
misc_feature <1..>438 /gene="LOC102260737" /note="sodium or proton efflux -- potassium uptake antiporter, P-type ATPase, alpha subunit; Region: ATPase-IIC_X-K; TIGR01106" /db_xref="CDD:273445" ORIGIN
gtgattatggtgacgggggatcatcccatcacagccaaggccattgccaagggtgtgggcatcatctcagaaggtaatgagaccgaagaggacattgctgaccggctcaagatccctgtcgaccaggtcaatagcagggatgccaaagccattgtggtgcacggctcaaaactaaaggatctgaactcagaacagcttgactatatcctccaaaaccacacggagattgtgtttgctcggacctccccgcagcagaagctcatcattgtagagggatgtcagaggctgggagccatcgtggcggtgacgggcgacggggtgaacgactccccggcgctgaagaaggcggacatcggcatcgccatgggcatctcgggctccgacgtctctaagcaggcagccgacatgatcctgctggacgacaacttcgcctccatc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]