GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:11:56, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_005420785            6137 bp    mRNA    linear   VRT 06-OCT-2019
DEFINITION  PREDICTED: Geospiza fortis ATPase copper transporting beta (ATP7B),
            mRNA.
ACCESSION   XM_005420785
VERSION     XM_005420785.2
DBLINK      BioProject: PRJNA217051
KEYWORDS    RefSeq.
SOURCE      Geospiza fortis (medium ground-finch)
  ORGANISM  Geospiza fortis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Thraupidae;
            Geospiza.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005054322.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 6, 2019 this sequence version replaced XM_005420785.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Geospiza fortis Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6137
                     /organism="Geospiza fortis"
                     /mol_type="mRNA"
                     /db_xref="taxon:48883"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..6137
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 8 Proteins, and 88%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:102045062"
     CDS             152..4744
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_005420842.1"
                     /db_xref="GeneID:102045062"
                     /translation="
MERKLDNKMKKELSYLATLNDRNISLLSIRKQQAARDVPELLIIGEKSKMASPPKASSNLQKEEKLSQSYSMGMTEVSTDERQALSNIDSPPGCELKPTMKHNFAFDNMGYEASSETMPSPPSQEHIVVLNIVGMTCQSCVQSIEGRISKVKGILRIKVSLEQNNAVIKYRQSEISPEQICQEILDMGFDANIAEEKLTTATVNFPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIVYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLDSDGLDLLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKAASSSGAFTYNVVRQPPQGMTHVAVIKIDGMTCHSCVQSIEGAVSQRQGVQNVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTDTAPGEHRCQPDGSKAAVQSQASEPPHHGNSPDALLDSPHPDGSNQLSGAIEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLSHKKEIQQWRKSFLYSLVFGIPVVVLMIYMQVPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWHFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILIVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVVKKPGSTVIAGSINAYGSLLVNATHVGGDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGDSSAPLGDNGVIPLLESQGPSASEKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINGADEEQYI"
     misc_feature    536..724
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(554..562,569..571)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    791..982
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(809..817,824..826)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1127..1303
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1145..1153,1160..1162)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1427..1618
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1445..1453,1460..1462)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1793..1984
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1811..1819,1826..1828)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2015..4420
                     /gene="ATP7B"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
     misc_feature    2021..2212
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2039..2047,2054..2056)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2627..3370
                     /gene="ATP7B"
                     /note="E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122"
                     /db_xref="CDD:278548"
     misc_feature    <3971..4282
                     /gene="ATP7B"
                     /note="Soluble P-type ATPase [General function prediction
                     only]; Region: COG4087"
                     /db_xref="CDD:226572"
     misc_feature    4013..4015
                     /gene="ATP7B"
                     /note="motif II; other site"
                     /db_xref="CDD:119389"
ORIGIN      
gatgaatgcctaataagcacatggattagacgggcagaactcttccagctgttgtaaatgtagctgaaagaagcgtggcttagaggacaacaaataactgctctcgtgaaacttttttttggctttgcaatatttaaagtccagaaaaataatggagagaaaactggacaataaaatgaaaaaggaactgtcctacttagctactttaaacgacagaaacatatccttgctgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagatggcatctccgccaaaagcaagcagtaacttgcagaaagaagagaaactttcgcagagttactccatgggcatgacagaagtcagtacagatgaaaggcaggctttgtccaacattgattctcctcctggctgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggcgagctctgaaaccatgccctctccaccttcccaagagcatattgtggtactcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgctgttatcaagtatcggcagtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagcagaagagaagttgacaacagcaactgtaaattttccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacctgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggagtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgtttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacctgcaagccttgatagtgatgggctggacctgctggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagccctgatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtaagcctccttagtggttcagaagcaaataaagcagcatcttcctcaggtgctttcacatacaatgtcgtcagacagccgccacaaggcatgacacatgtggctgttattaagattgatggcatgacctgccattcttgtgtacagtccatagaaggggccgtatcacagaggcagggggtgcagaatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcactagtggagaagaattaagagctgccatagaagatatgggatttgatgcctctgtgctgacagacaccgcccctggagaacacaggtgccagcctgatggcagcaaagctgctgtgcagtctcaagcttcagagcctcctcaccatggcaattccccagatgctcttctagacagtcctcaccctgatgggtcaaaccagctcagtggagccatagaagaaaagtgtgttttacagatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctaagtcataaaaaggaaatacagcagtggaggaaatctttcttatacagcctagtgtttggtatccctgttgtagtcttaatgatttatatgcaagtacccaatggtgaagaccatgggtctaaggtgctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcactttcgttcagttccttggtggatggcatttttatgtgcaagcctacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgtgtgatcctgatagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcactcggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgactcttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcagaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgatggcagttctatggcagatgagtctctcattactggggaacctatgccagtcgttaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtggtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataattctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggctgttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcacggacttccaggcagtccccggctgtggtatcagctgcaaggtcggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactggggacagcagtgctcctctgggagataatggagttatcccactcttggaatcacaaggtccatcagcttctgagaaatactcggtgttgatcggaaatcgtgagtggatgcgacgcaacggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtgcgttgtgcggaatgatcgccatagcagacaccgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcggaggttcttccttctcacaaggttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggccgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgttcttatccgaaatgatttgctggatgtagttgccagtattcacttgtccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactacagctgaaatgttacaagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccactcactccttctcaaatcagtgtccacattggaatggacgataggaggagggactcttccaaaccgtctccttgggaccagacaagccaagtgtccctctcctccttggcttcagacagactgccaagacacaatggcttcatccaggaggaagggggcaaatggtcattgctcataaacggagcagatgaggagcagtacatctgaagctcgggactctttgtgcagggggaaatgttcctcctccccagccaggggagggactgacttatttcatcaacagcttcagtgctgtaagtgaagtattccttcagctcataagacaattgcaactcagctcagcgttgggttgtatggattgtggatttttttcaagtcaccagttctttctagttatgaaaatattctgtgccactgtaatgaactggcttgtttgcacacagcatttagtgaaataatgcaaaattgtaatttgtagagtctaaaagagtttctctgtgactctttgctaggaaccaaatttcatacttttcactctttcaaactttattacttcaagaccacatgaagcaagagtattttcagagctgccaaatattaatttgtgtctaaatgaaattagcaatggcataaggaactctgtggtcagaatttgaatttttacacagaactagccatgtcactgtgagaacactttgcgtttaggattcatggcatctcctgggaccaaaaatgctttgttgtttcacctacttcaactctctgaaaggtctttttcaaagattttcactgctttgaggtattgcatccttttgatgcacgtttctactactgtctttgattttctcttttgccccataggaccccctttcccctttttcttgcacaagagatcttctatgagttatcattatgtttacagatattcctgtttggaacaaactcctttaagtcaccaggaacctttccattccagttgaaatccataaaggcagaacagttcctgatcccagttgtccaagacaccttgctggaccccagggagctccttagagttgggaagttgtctgtctctttcctctgacagagtgaagaatttatgccagtgtgagcaaaggtggtatttaccttggcatgactgagcagagctagcactggtgtgactccagtgcagctgaacagagggggattattgcataacttaaacccagcttgctggttgcttaaaatgcagctaaaagtttaaatgataaaggtggaaaaatggccttaagtgggcttctgtttgctatcatatgaataaatgacagaacctgaagtaagaaaatttgtaatttaaatttgtatttatttttttgcattggttttagtttccctctttacttcaatgaaaaatcaaagtactggacaaccgtttttttgctttaacatctttaccaaagcttgcagtaacttcacctctgtggatgtcagattcaccccttaacactttttaggatcagaacagtaggaatcaacagctttggtgcactggatccagttccagagcactgtgttgtccaggtgtgggactctgatgtaagccgaggtttatagtcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]