GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 06:24:14, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_005068411            3667 bp    mRNA    linear   ROD 14-APR-2021
DEFINITION  PREDICTED: Mesocricetus auratus NRDE-2, necessary for RNA
            interference, domain containing (Nrde2), mRNA.
ACCESSION   XM_005068411
VERSION     XM_005068411.4
DBLINK      BioProject: PRJNA719779
KEYWORDS    RefSeq.
SOURCE      Mesocricetus auratus (golden hamster)
  ORGANISM  Mesocricetus auratus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Cricetidae; Cricetinae; Mesocricetus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024429186.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 14, 2021 this sequence version replaced XM_005068411.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mesocricetus auratus Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3667
                     /organism="Mesocricetus auratus"
                     /mol_type="mRNA"
                     /isolate="SY011"
                     /db_xref="taxon:10036"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
                     /dev_stage="adult"
     gene            1..3667
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 68 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101829418"
     CDS             74..3562
                     /gene="Nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2"
                     /protein_id="XP_005068468.1"
                     /db_xref="GeneID:101829418"
                     /translation="
MALFPAFAGLSEASGGGASRKELDWLSNPSFCVGSLTALSQQAEEVTALASGGSPLTRSPLKSELSDESDTSQTLTQISRRKKKEKKKKRKHQHRKKTKRRHEQSSSGGSESDTDSGKGRSSRSLKDSQKESEKPSQGSNAVAAGHQSIWLEDIQTPTEVFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGTPAAKKHSRKHLERYFTKKNVGLMRTEGIAVCASTEPPSSEPITFIPVKDSADAATPVATWLNPLGIYDQSTTQWLQGQGPPEQESKQPDSQQDRESAALKAKVEEFNRKVRENPRDTQLWMAFVAFQDEVMRSPGLYALEEGEQEKHRKSLKLLLEKKLAVLERAIESNPSSVDLKLAKLQLCAEFWEPSALAKEWQKLLFLHPNNTDLWQRYLSFCQSQFGTFSVSKLHNLYGKCLSTLSAVKDGSILSHPVLPGTEEAMFALFLQQCHFLRQAGHSEKVISLFQAMVDFTFFKPDSVKELPTKAQVEFFEPFWDSGEPRVGEKGARGWRAWMHQQERGGWVLVNPDEDEEEPEEDDQEIKDKTLPRWQIWLAVERSRDQRHWRPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLCSPSLQFQLIEAFLQFLGVPSGFLPPASCLYLAMDESSIFDSELYDAKPLTYFNPSFSGISCVGYMEQLGCPRWTKGHSREGEEFVRNVFHLVLPLFSGKQKSQLCLSWLRYEVAKVIWCLHTKKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNIEDARKVFDTALSMAGSSELKDRELCELSLLYAELEMELSPDSRGATTGRAVHVLTRLTESSPYGPYTGQVMATQVLKARKAYEHALQDCLGQTCASGPDTAESLDCLGSLVRCFMLFQYLTVGIDAAVHIYGQVFAKLKGSVLPEGPGPKDSASSQSVNSVLEAVTLMHTSLLRFHMNTSVYPLAPLRETLAEALRLYPGNQVLWRAYVQIQNKSHSANKTRRFLDGVATSAKHLEPRLFAIEAEKMRKGLVESVQRVGGREVHATIPETGLTHRIRALFENAIRSDKGSQCPLLWRMYLKFLVSLGNKERSKGVFYKALQSCPWAKVLYMDAMEYFPDELQEILDVMTEKELRVRLPLEELELLLED"
     misc_feature    1007..2005
                     /gene="Nrde2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
gacagagtcctccaaccagaactctccagacggcgccatttctgtggagggagtggcggtgcggcctgtgaacatggcgctgttcccggcctttgcgggcttaagtgaagcctccggcggtggagcatccaggaaagaattagactggctgagcaacccaagcttttgtgttggaagtctaacggctctgagccaacaagctgaagaggtcacagcccttgcttctggagggtcaccactgacaaggagtcctctgaagtcagagctctcagatgagagtgatactagccagacactcacacagataagcagaagaaagaagaaagagaaaaagaagaaaaggaaacatcagcaccgcaagaaaactaagaggagacacgagcagtcgagcagtggcgggtctgagtcagacacagattctgggaagggcaggtcttccagaagcctcaaggacagtcagaaggaatctgagaaacccagtcaaggaagtaatgctgttgctgctggacaccagtccatttggctggaagacattcagactccgacagaagtcttcaggacagacaagaagccagatcctgccaactgggagtataaatctctctaccgaggggatattgcaaggtataaaaggaaaggagactcctgcctgggcattaaccctaagaaacagtgtatatcctgggaagggactcctgcggctaagaagcattcacgcaagcacctggagcgctattttaccaagaagaacgtgggattaatgcgcactgaggggattgccgtgtgcgctagcactgagcctccctcttctgagccaatcacatttatcccagtgaaggactctgctgatgcagctactcctgttgcaacgtggctgaatcctctggggatttacgatcagtcaactacacagtggttacaaggacagggtcctccagagcaagaatcaaagcagccagactcacagcaggacagggagagtgctgctcttaaagccaaggtggaggagttcaacagaaaggtgcgggagaatccccgggatactcagctgtggatggcctttgtagcgttccaggacgaagtcatgaggagtcctggcctgtatgcccttgaggaaggagagcaggagaagcacaggaagtccctgaagctcctcctggagaagaagctagccgtgctggagcgggccatcgagagcaacccgagcagcgtggacctgaagctcgccaagctgcagctgtgcgcggagttctgggagcccagcgcgctggccaaggagtggcagaagctcctctttctgcaccccaacaacacggacctgtggcagcgctacctctccttttgccagagtcagtttggcaccttttctgtgtccaaactccacaatctctatggcaagtgcttgagtaccctgtctgctgttaaggacggcagcatcttgtcccaccctgtgctgccgggcacggaggaggccatgtttgccctttttcttcagcagtgtcactttctacggcaggccggccactcggagaaggtcatctctttgttccaggccatggttgacttcaccttcttcaagcctgacagtgtgaaagagctgcctaccaaagcacaggtggaattctttgaacccttctgggacagcggagagcctcgtgttggggagaagggagcccgaggctggcgggcatggatgcaccagcaggagcgtggcggttgggtgctcgtcaacccagatgaggatgaggaggagccagaagaggatgaccaggagataaaagataagactctgcccaggtggcagatctggcttgctgttgaacgttctcgagaccagaggcactggcggccctggcgcccagataagaccaagaagcaaacagaggaagattgtgaggaccccgagagacaggtgctgtttgatgatattggacagtctctgatcagactttgcagcccgagtcttcagttccagctcattgaggcctttctgcagttcttgggcgtgccttccggattccttcctccagcctcctgcctgtacctggccatggacgagagcagcatctttgacagtgagctttatgatgcaaagcccttgacttacttcaacccttccttctcgggcattagctgtgttggctacatggaacagctgggctgtcctcgctggaccaaaggtcacagccgagagggcgaggagtttgtccgcaacgtcttccacctcgtgctgcctctgttctcaggcaaacagaagtctcagctctgcctctcctggttgcggtacgaggttgccaaggtcatttggtgtctacacaccaaaaagaagcgattaaaatctcagggaaagaactgcaaaaaactagccaagaatctactcaaagagccagaaaaccgcaacaacttttgcctctggaagcagtatgcacacctggagtggttgcttggcaacatagaggatgccagaaaagtgttcgatacagcactcagcatggcaggcagcagtgagctgaaggaccgtgaactctgtgaactcagtctgctttatgccgagctggagatggaactgtcgccggactcgagaggtgccaccacaggccgagctgtccatgtgttaactcgactgactgagagcagcccctatggtccctacactgggcaggtcatggccacacaggttctgaaggcccgaaaggcttatgaacacgcgctgcaggactgtctgggacagacttgtgcctctggccccgatactgcagagtccttggactgcctgggtagcttggtcagatgcttcatgcttttccagtatttgactgtagggatcgatgctgctgtgcacatctatggacaggtgtttgccaagctgaagggctctgttcttccagaaggccctgggcccaaggacagtgccagctcccagagtgtgaacagtgttctggaagctgtcaccctgatgcatacaagtctgctgcgattccacatgaacactagtgtgtaccctctggctcccctccgagagacgctggcagaggccctaaggctgtatccaggcaatcaggttctctggagggcgtatgtacagattcagaataagtcccacagtgctaacaagaccaggaggttcttggatggagtcgccacgtctgctaaacacctggagcctcgattgtttgcaatcgaagctgagaagatgaggaaaggactggtggagtctgttcagagggtaggtggtagagaggttcatgccaccatcccggagacaggcctcacgcatcggatcagggccttgtttgaaaatgcaattcggagcgacaagggcagccagtgccccctactgtggaggatgtatttgaaatttttggtttccttaggaaacaaggagagaagcaaaggtgtgttctacaaggcactccagagctgtccttgggcaaaggtgctgtacatggatgccatggagtacttcccagacgagttgcaagagatcctggatgtgatgactgagaaggagcttcgtgtacgcctgcccctggaggagctggaactactgctggaggactagggggctcaggagagccgcagccggacttactgttttacatattatatatgtaaccaactatatgtatagatggagtcatgccagtgataaaccttttgtggttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]