GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:28:51, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_004635132            3589 bp    mRNA    linear   ROD 24-JAN-2018
DEFINITION  PREDICTED: Octodon degus NRDE-2, necessary for RNA interference,
            domain containing (Nrde2), mRNA.
ACCESSION   XM_004635132
VERSION     XM_004635132.2
DBLINK      BioProject: PRJNA193441
KEYWORDS    RefSeq.
SOURCE      Octodon degus (degu)
  ORGANISM  Octodon degus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricognathi; Octodontidae; Octodon.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004524646.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 24, 2018 this sequence version replaced XM_004635132.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Octodon degus Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3589
                     /organism="Octodon degus"
                     /mol_type="mRNA"
                     /isolate="3935"
                     /db_xref="taxon:10160"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..3589
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 mRNAs, 2 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:101593331"
     CDS             397..3432
                     /gene="Nrde2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_004635189.1"
                     /db_xref="GeneID:101593331"
                     /translation="
MQTLTGEIFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCVSWEGVSTAKKHSHKHIERYFTKKSVGLMNIDGAAVTSKVEPPSSEPVLFIPVKDSEDVAAPVTSWLNPLGIYDQSTTQWLQGQGPSGQESKQSDSQPDRENAVLKAKVEEFNRKVRENPRDIQLWMAFVAFQDEVMKSPGLYAIEDGEQEKRKKSLKLILEKKLAILERAIESNQSSVDLKLAKLKLCTEFWEPPTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIHNLYGKCLSTLSAVQDGSILSHPALPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKVQVEFFEPFWDSGEPRPGEKGARGWRAWVHQQERGGWVVVSPDEDGDEPEEEEQEMSDKTLPRWRIWLAAERSRDQRHWRPWRPDRTKKQAEDDCEDPERQVLFDDIGQSLIRLASEALRFQLIEAFLQFLGVPSGFIPPASCLYLAMDENSIFDNRLYEEKPLTFFSPSFSGVSCVGHLEQLGCPRWARGHDREGEEFIRNIFHLVMPLFSGKQKSQLCFSWLRYEIAKVIWCLHTKNKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNIEDSRKVFDTAVSMAGSSELKDRELCELSLLYAELEVELLQDLRGAAAGRAVHILTKLTESSSYGPYTGQVSGTQVLKARKAYEHALQDCLGENCVSGPAATDSLDCLSSLVKCFMLFQYLTVGIDAAVRIYEQLFIKLKGSVVPEGPGLEDSASSQSLTSVLEAITLMHTSLLRFHMKVTAYPLTPLREALSEALKLYPGNQVLWWSYVQIQNKSHSASKTRRFFDALTRSAKQLEPWLFAIEAERMRKRLVETVQRVDGQEINATFPETGLTHRIRALFENAMRSDSGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQHCPWAKVLYLDAVEYFPDQLQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    874..1872
                     /gene="Nrde2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
ttagactggttgagcaacccaagcttttgtgttggaacgataaccgcgctgagccaagacaccaaggaggccacagcccttgtttcccaagcgtccgcactgacaaggagtcctctgaaatcagagctttccgatgaaagtgacactaacacaaagcttgtacaaacaagcagaaaaaagaagaaggagaaaaagaaaaaaaagaagcatcagcactacaagaagacaaagaggaaacatgggcagtcaggtagcagtgagtctgagcttgatactgactctggaaaggatggatcgtccagaagcatcaggagtagtcggaaggaatctgagaaagccagtcaaggaaataatgttgctgctgatgtcggacatcattccatttggcttgaggacatgcagactctgacaggagaaatcttcagaactgataagaaaccggatcctgcaaactgggaatataagtctctttaccgaggggatatagcaaggtataagaggaaaggggactcctgcctgggcattaatcctaagaaacagtgtgtatcttgggaaggcgtttccacagccaagaagcattcacacaagcacatcgaacgctattttaccaagaagagtgtgggattaatgaacatcgacggagctgctgttaccagtaaagttgagcctccgtcctccgagccagtcttgtttatcccagtgaaggactcggaagatgtggctgctccagttacaagctggctgaatcctctggggatttatgatcagtcaaccacacagtggttacaaggacagggtccttcagggcaggaatcaaagcagtcagactcccagccagatagagagaatgctgttctcaaggccaaggtggaggagtttaacaggaaggttcgggagaatcctcgggacattcagctgtggatggcatttgtggcttttcaggatgaggtcatgaagagccctggcctgtatgccattgaggatggagagcaggagaaacggaagaagtccttgaagctcatcctggagaagaagctggccattctggagcgggccattgagagcaaccagagcagcgtggacctgaagctcgccaagctgaagctctgcaccgagttctgggagcctcccaccctggtcaaagagtggcagaaactgatctttctccatcccaacaataccgccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatttccaaaatccacaacctttatggaaagtgcttgagcactttgtctgcggtccaggatggcagcatcctgtcacaccctgcgctgcctggcacagaagaggccatgtttgcgctctttcttcagcagtgccattttctgcggcaggctggccactcggagaaggctgtctctttgttccaagccatggttgatttcaccttcttcaaacccgacagtgtgaaagatcttcccaccaaagtccaggtagaattctttgagcccttctgggacagtggagagccaagacctggggagaagggcgcccgtggctggcgtgcatgggtgcaccagcaggagcgcggtggctgggtggtcgtcagcccagatgaggacggtgatgagccagaagaggaggaacaggagatgagcgacaagacccttcccaggtggcggatctggcttgctgccgagcgttcccgagaccagaggcactggcggccctggcgccctgataggacgaagaagcaagctgaagacgactgtgaggaccctgagcgacaggtattgtttgacgacattggacagtcactgatcagactggccagcgaagccctccggttccagctgattgaggcctttttgcagttcttgggtgtgccctctggcttcatccctccagcctcctgcctttacctggccatggatgagaacagcatctttgataacagactttatgaggaaaagcccttgacttttttcagcccttcattttctggtgtcagctgtgttggccacctggagcagttgggctgtcctcgctgggccaggggtcacgatcgagaaggcgaggagttcatccgcaacatcttccaccttgtgatgcctttattttcaggcaagcaaaagtctcagctctgcttctcctggttacggtatgagattgcaaaggtcatttggtgtctgcacactaaaaataagaagagattaaagtcacaggggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaataatttttgcctctggaagcagtatgcacatctggagtggttactcggcaacatagaggactccaggaaagtgttcgataccgcagtcagcatggcaggcagcagtgagctgaaggaccgcgagctctgcgagctcagtctgctctacgccgagctggaggtggagctgttgcaggacttgagaggggctgccgcgggccgggctgttcacattctcaccaaactgacggagagcagctcctatggcccctacactgggcaggtctcgggcactcaggttttgaaagctcgcaaggcctatgagcatgcgctgcaggactgtctgggtgagaactgtgtctccgggccggcggctaccgattccttggactgcctgagtagcttggttaaatgcttcatgctcttccagtatttgactgtagggatcgatgctgctgtacggatatatgagcagcttttcatcaaactaaagggctctgttgtcccagaaggccctggcctggaggacagtgccagctcccaaagtttgaccagtgtgcttgaagccatcaccctgatgcacacaagtctgctgagattccacatgaaagttactgcttatcctctcactccactgcgtgaggcgctctcggaggctttaaaactgtatccaggcaaccaggttctttggtggtcatatgtacagattcaaaataagtcccacagtgccagcaagaccagaaggttttttgatgccctcaccaggtctgccaaacagttggagccttggttgtttgcaattgaagctgagagaatgaggaaaagactggtggaaactgttcagagggtagatggccaggagatcaatgccacattccccgagaccggcttaacacatcgaatcagagccctgtttgaaaatgcaatgcggagtgacagcggcagccagtgccccttactgtggaggatgtatttgaatttcctggtttccttaggaaacaaagaaagaagcaaaggtgtgttctacaaagcacttcagcactgtccttgggcaaaggtcttatacctggatgccgtggagtactttcctgaccagctgcaggaaatcctggatctgatgaccgagaaggagctccgtgtgcgcctgcccttggaggaactggagctcctgctggaggactaggctgccagacacgtgtgcactctgtcctggtcatttccttcagcacagcttttggacgtgtacaccacacaaaaactgttgttcttagtattctgtatgtgactacgaacacagatgcggacctatggttggggatgatgaaatcttttgagattga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]