GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:03:35, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_003756162            4473 bp    mRNA    linear   MAM 31-DEC-2019
DEFINITION  PREDICTED: Sarcophilus harrisii NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X2,
            mRNA.
ACCESSION   XM_003756162
VERSION     XM_003756162.4
DBLINK      BioProject: PRJNA596784
KEYWORDS    RefSeq.
SOURCE      Sarcophilus harrisii (Tasmanian devil)
  ORGANISM  Sarcophilus harrisii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Metatheria; Dasyuromorphia; Dasyuridae; Sarcophilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045427.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 31, 2019 this sequence version replaced XM_003756162.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sarcophilus harrisii Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4473
                     /organism="Sarcophilus harrisii"
                     /mol_type="mRNA"
                     /db_xref="taxon:9305"
                     /chromosome="2"
                     /cell_line="91H"
     gene            1..4473
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, 2 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 35 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:100929271"
     CDS             152..3757
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X2"
                     /protein_id="XP_003756210.2"
                     /db_xref="GeneID:100929271"
                     /translation="
MPRAQRAHAQCSISGVYPYVRVTEWGRRPWPGTMALFPAFAGVSAAPESSAGGSSRKDLDWLSNPSFCTGNVPTLQQNTVEITALASEKELLTRSPLKLELSEGSDTHKRIKQASRKKKKEKKKKKKHQHHKKTKKKYEQSSDSESYSATDSEKETSTGCIIYSKKEVEKPNQENNATDNSGSHLVWLDDIQTLTTETFRTDKKPDPANWEYKSLYRGDIARYKRKGNSCLGINPKKQRISWEGTSTEKKQLHKKFERYFSKKSMRSVSSDGAPVCSKAEVFSSDLSPFIPVKDSDDEVPSSTSTWVNPLGVYDKSTTLWLQGQGPSDQETKQPTSQKDSEEVILKAKVEEFNRKVRENPRDIQLWLEFVSFQDEVMKRPSLYTISEGEQESRRKSLKLILEKKLSILERAIESNQNSVELKLARLKLCTEFWEPSTLIKEWQKLIFLHPNNTSLWQKYLLFCQSQFSTFTVSKIHNLYGKCLSTLAAVQDGSILSHPALPGTEEAMFALFLQQCHFLRQAGHTEKAISLFQAMIDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRVGEKGARGWRAWMHQQERGGWVVIKPDEDEDEPEEDDQEIKNKTLPKWQIWLSVEHSREQRHWLPWRPDKTKKQTDEDCDDPERQVLFDDLGLSLIKLPSLDLKFQLIDSFLQFLGVPSSYNLPASCLYLAMDENGIFDDGISDEKPLTFFNPSFSGINCVGRMDKMNRQEHRMGHCKEGEEFIQNIFHLVLPLFSGKEKSHLCLSWLQYEIAKVTWCLQTKNKKRLKSQGKKCKKLAKNLLKEPDNRNNFCLWKAYAHLEWLLGNIEDARKVFDTAISMAGPEDLSSRLFDLSLLYAELEVELSGNLEGATTSRAIHILTKLTENGPYIPYTGQVLAMNILKARKAYEHMLQKHLNESSAPDPSSFNCSGHLVGMVGCFMLFQYLTIGVNAAMHIYKQVYERLKGSISSEFSRLSANIGAQNLTNALEAVTLMHANLLRYHMKVSVFPLNPLRETLSEALKLYPDNQVLWRSYIQIQNKSHNASKTRRFFDIIIRSSESLEPRLFAIQAEKMRKRLVEAVLREEAGEIHSTIPETGLSNRIKVLFENAVQSDNGSNCPLLWRMYLNFLVSLGNKERSKGVFYRALQHCPWAKVLYMDAMDYFPDQFQEILDLMTEKELRVRVPIEELELLLED"
     misc_feature    1202..1918
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
taaatgacactgtggtggtcggtttgaagatattgcaaaatgaggttggattgtggggcctggaagcccccggcctcttgagttccacggcggtctatctcggctaaacagtctcacttacacacagcgctaaaagaccacatcccccacaatgccccgcgcccagcgcgcgcatgctcagtgctcgatatcgggtgtttatccttatgtgcgtgttacggagtggggccggcggccctggcccggaaccatggccctgttcccggcctttgctggtgttagtgcagcccctgagtcctccgctggtggtagctcgaggaaggatttagactggttgagcaacccaagcttttgtactggaaatgtgccaactctgcaacaaaatactgtagagattacagctcttgcttctgaaaaggaactgctcacaaggagccctttaaaactggaactttcagaagggagtgatacacacaaaaggattaaacaagcaagtagaaaaaagaagaaagaaaaaaagaaaaagaaaaaacaccaacatcacaagaaaaccaagaaaaaatatgagcagtctagtgacagtgaatcttattcagctactgactctgaaaaggagacatctacaggatgcatcatttacagtaaaaaggaagttgagaaaccaaaccaagaaaataatgccactgacaacagtggaagccaccttgtttggcttgatgacattcagaccctgacaacagaaactttcagaacagataagaaaccagatccagcaaactgggagtataaatccctttatcgtggagatatagcaagatacaagaggaagggaaactcttgccttggtattaaccccaaaaagcaacgtatatcttgggaaggtacctctacagaaaagaaacaattgcataagaaatttgaacgctacttttctaagaaaagcatgcgttcagtaagcagtgatggagctcctgtttgtagcaaagctgaagtattctcatctgatctcagcccattcatcccagtgaaagactctgatgatgaagttccatcttctacctcaacttgggtgaatcctttgggagtctatgataaatctacaacactctggttacaaggacagggtccttcagaccaagaaacaaagcaacctacatctcagaaagatagtgaagaagttattctaaaagctaaagtagaggaatttaacagaaaagtccgagagaatcctagggatattcaactgtggctggaatttgtgtcttttcaagatgaagtgatgaaaagaccaagcctatacaccatcagtgaaggagagcaagagtccagaagaaaatcactgaagctaattctggaaaagaaattgtccattttagaacgtgccattgaaagcaaccagaacagtgtggaactgaagcttgccaggctaaaactctgtacagaattctgggaaccatctactttgatcaaagagtggcagaaactgatttttttacaccccaataatacatccttatggcagaaatacctcttattttgccagagccaatttagcacctttacagtatccaaaattcacaatctgtatggaaaatgccttagcaccctggcagcagtacaagatgggagcatcttatctcatcctgcattgcctggaactgaagaagctatgttcgccctctttcttcagcagtgtcattttctcagacaagctggccacactgaaaaagcgatttctttgttccaagccatgattgactttaccttcttcaaacctgacagtgtgaaagatcttcctaccaggggacaggtggaattctttgaacctttttgggatagtggagaacctcgggttggagaaaagggagcaagaggctggcgagcctggatgcaccagcaagaaaggggtggctgggtcgttattaagcctgatgaggatgaagacgaacctgaggaggatgatcaagaaataaagaataaaactcttccaaagtggcagatctggctcagtgttgagcattcccgtgaacaaaggcactggctgccctggcgccctgacaaaaccaaaaaacaaactgacgaggattgtgatgacccagagagacaggtgttatttgatgatctaggcctatctctcataaaacttcctagtttggatctaaaatttcaactgattgattcatttctacaattcttgggagtcccttcaagctataatcttccagcttcatgcctctatcttgccatggatgaaaatggtattttcgatgatgggatttctgatgaaaaaccattgacttttttcaatccatcattttccgggattaattgcgtcggtcgcatggacaaaatgaacagacaggaacatcggatgggtcactgcaaagaaggcgaggagttcatacagaatatatttcatcttgtattgcccctattttcagggaaagaaaaatctcatctctgcctttcgtggttacagtatgaaattgctaaggtcacttggtgtctgcaaactaaaaacaagaagagactgaagtctcaagggaaaaaatgcaaaaaactagccaagaatctcctcaaggaacctgacaacagaaacaacttttgcctttggaaagcatatgcccacctagaatggttacttggcaacatagaagatgcaaggaaggtttttgacactgctattagcatggcagggccagaagacttaagttctagactctttgacttaagcttgctttatgctgaactagaagtagaactctcagggaacttggaaggggctactacatccagagcaattcatatattaactaaactgactgagaatggtccatacataccttatactggacaggtattagctatgaacattttgaaagcccgcaaagcatatgagcacatgctgcagaagcatttaaatgaaagttcagctcctgacccatcttcttttaattgttctggtcatttggttggcatggttggctgctttatgcttttccagtatttgaccataggagttaatgctgctatgcatatatataaacaagtgtatgaaagacttaaagggtccatttcatcagaattctcaaggctgagtgcaaatattggagcccaaaatttgaccaatgcccttgaagctgtcacactgatgcatgcaaatctactcaggtaccacatgaaagtgagtgtgttccctttgaatcctctgagagaaacgctttcagaggctttaaaattatatccggacaaccaggttctttggagatcgtatatacagatccaaaataaatcccataatgccagcaagacaagaagattctttgatatcattataaggtcttccgaatccctagagccacggctgtttgcaatccaagctgagaaaatgagaaaaaggctggtggaagctgttctgagagaagaagctggagaaatccattcaacaattcctgaaacaggtttatcaaatcgaatcaaagtcttatttgaaaatgcagttcagagtgataatggcagcaattgccccttgttatggaggatgtatttgaattttctggtttctctaggaaacaaagaacgaagcaaaggtgtattttacagagccctccagcactgtccttgggcaaaggtgttatatatggatgcaatggattatttccctgatcaattccaggaaatcctggatctgatgactgaaaaggaattaagagttcgggtaccaatagaagaactagagcttctcttagaagattaataatgagtggaacaagatgattaatggagttaagactgaggtttgacagtcctgtaatagctgtgggaatgtacaaattgggaaacttggactaggagtggaacatttttttcctttattttttaaggacttatttaaaattttaaggtttctgggccagtgtaatgtatttttaagtattcagatgtctctcacaacctccatgtgtttagaagatttatttacacagaatgagttattttatagatcatatatatgaatatgatgtacatatgtacagaaagacagacttgggaataaataaatcttttgtaattggttccctttaaagccaatgcttcatgtggttcattatcagcatgctaaatgtttcttcttagaggacttggagatcaagagccaagtatactcgcctccttcacctgaattagatgtgggttatgtatgattctggggctaaagatctaatcctattgtgaccatcatctgttagggatcatttatttgcgtaaaataaaactttgaccttctctttgccaagtcaaatttgagggttgatatttttcagtcacgttcaactttgtgaccctgtgaaccatactgtctatgggttttcttggcaaaaatttctctgaaaacacatctcacttttaaagaagactccgtggcttcatgcaccaagttggtagtttgttagctatgatattcctatcata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]