GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-20 12:09:46, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_003107901           21927 bp    mRNA    linear   INV 13-OCT-2010
DEFINITION  Caenorhabditis remanei CRE-TAG-80 protein (Cre-tag-80) mRNA,
            complete cds.
ACCESSION   XM_003107901
VERSION     XM_003107901.1
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis remanei
  ORGANISM  Caenorhabditis remanei
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis.
REFERENCE   1  (bases 1 to 21927)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     PCAP assembly of the Caenorhabditis remanei genome
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 21927)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (17-JUL-2007) Genome Sequencing Center, Washington
            University School of Medicine, 4444 Forest Park Parkway, St. Louis,
            MO 63108, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003319680).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..21927
                     /organism="Caenorhabditis remanei"
                     /mol_type="mRNA"
                     /strain="PB4641"
                     /db_xref="taxon:31234"
     gene            <1..>21927
                     /gene="Cre-tag-80"
                     /locus_tag="CRE_12524"
                     /db_xref="GeneID:9828533"
                     /db_xref="WormBase:WBGene00075505"
     CDS             1..21927
                     /gene="Cre-tag-80"
                     /locus_tag="CRE_12524"
                     /note="contains similarity to Interpro domain IPR002048
                     (Calcium-binding EF-hand)"
                     /codon_start=1
                     /product="CRE-TAG-80 protein"
                     /protein_id="XP_003107949.1"
                     /db_xref="InterPro:IPR002048"
                     /db_xref="WormBase:CRE12524"
                     /db_xref="GeneID:9828533"
                     /db_xref="WormBase:WBGene00075505"
                     /translation="
MSSWFSYFGFSKGPPLEEVTEESEEEETQVPEHVVPKTAEEELAEAMNRLSPEQQSMIQDVLRRAENSRKEAKVVVDAEMMRSRYRQRESIEGSQDIDHRYSLVQMDSIPENMVTNEMEERAASQREFMHESSQKSPISPNVTRKLHEKRPSITEGISSVVFKNFVIFSNSATTESLRNRFQKMKSHLTTWFNSLDYDGEYTFDFTSKHDKSEKLSDLTMQYIDALSQAIMISSHIEYSHYLLSSNPDFHLMCTNFCESIFNLAFDDLADQTVDENVRDKLNDFCGRIAEEALQSAFFMMVSKTLSSSKDSFRCENIINEISLLHKSRSFESAQQLDQFLSKIENEDEDRESSRKSSPYMYEVLGTSSESPSSSSSYEFKSQNSYESEVSNETPNVHVEELFDLQPYDTYKTDDDEEVFRSENILFECSQTSTPDNSLKEKTEEATSFMTPGEEHYIWISGPLGRINEEHEHDDEDDEVQTESSSDSMIMHENSSEPIMQLNVEEYIQTMIEKVSDPSFSENTNETYNEVPCCSTEDEETRKIHETAKILVQETMEQLIYDSPTEFEKRVNTPEHHEADRSSATSGADFEKSLDQEVAYDRSSPFLEPVEEPIFEKKEPELTQEEIDHIAWIQSLAERSSFEQAAPPTHPPVPQRMATVEEPIATTDLHEEDRSSATSGAHFEKSFDQEVAYERSSPLLESVEEPIFEKKEPELTQEEIDHIAWIQSLAQQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEQSFDQEVAYDRSSPLLEPVEEPIFEKKEPELTQEEIDHIAFIQSLAQQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEQSFDQEVAYDRSSPLLESVEEPMLEKKEPELTQEEIDHIAWIQSLAQQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADLEQSXXXXSLGFKACSTSDSSTIEEPVVTTDLHEEDRSSATSGADFEQSFDQEVVYDRSSPLLEPVEEPILEKKEPGLTQEEIDHIAWIQSLAHQLSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYDRSSPLLESVEEPMLEKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMAIVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYDRSSPLLEPVEEPIFKKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQKMAAVEEPVVTTDVHEEDRSSATSGADIEQSFDQEVAYDRSSPLLEPVEEPILERKSGTDSREIDHIAWIQDRSSATSGADFEQSFDQEVAYDRSSPLMESVEEPILGEERNPELTQEEIDHIAWIQSLAEQSSFEQAALPTRPPVPQRMATVDEPVAMTDVHEEDRSSATSGADFEQSFDQEVAYERSSPLMESVEEPILEKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMATVDEPVAMTDVHEEDRSSATSGADLEQSLDQEVAYDRSSPLLEPVEEPILEKKEPELTQEEIDHIAWIQSLAHQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEQSFDQEVAYDRSSPLLESVEEPMLEKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMAIVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYDRSSPLLEPVDEPIFKKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQKMATVEEPVVTTDVHEEDRSSATSGADFEKSFDQEVAYDRSSPLLEPVEEPIFKKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDVHEEDRSSATSGADFEKSFDQEVAYDRSSPLLEPVEEPIFKKKEPELTQEEIDHIAWIQSLAEQSSFEQAALPTRPPVPQRMATVDEPVAMTDVHEEDRSSATSGADFEQSFDQEVAYERSSPLMESVEEPILEKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMATVDEPVAMTDVHEEDRSSATSGADFEQSFDQEVAYERSSPLMESVEEPILEKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMATVEEPVAMTDVHEEDRSSATSGADFEKSFDQEVAYDRSSLLLEPVEEPIFKKKEPELTQEEIDHIAWIQSLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADLEQSLDQEVAYDRSSPLLEPVEEPILEKKEPELTQEEIDHIAFIQRLAEQSSFQQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYDRSSPLLESVEEPILEKKEPELTQEEIDHIAFIQRLVEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEQSFHQEVAYDRSSPLLEFVEEPILEKKEPELTQEEIDHIAFIQRLVEQSSFEQAALPTRPPVPQRMATVEEPKPILEKKEPELTQEEIDHIAFIQRLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYDRSSPLLESVEEPILEKKEPELTQEEIDHIAFIQRLAEQSSFEQAAPPTCPPVPQRMATVEEPIATTDLHEEDRSSATSGADFEQSFDQEVAYDRSSPLLEPVEGPILEKKEPELTQEEIDHIAWIQSLAQQSSFEQAAPPTRPPVLQRMATVGEPVVTTDLHEEDRASATSGADFEQSFDQEVAHERSSPLLKSVEEPILEKKEPELTQEEIDHIAFIQRLAEQSSFEQAAPPTRPPVPQRMATVEEPIAMTDLHEEDRASATSGADFEQSFDQEVAYDRSSPLLEPVEEPILEKKEPELTQEEIDHIAWIQSLAQQSSFEQAAPPTRPPVLQRMATVEEPVVTTDLHEEDRSSATSGADFEKSIDQEVAYDRSSPLLESVEEPILEKKEPELIQEEIDHIAFIQRLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFKKSFDQEVAYDRSSPLLESVEEPILEKKEPELTQEEIDHIAWIQRLAEQSSFEQAAPPTRPPVPQRMATVEEPVATTDLHEEDRSSATSGADFEQSFDQEVAYDRSSPLLESVEEPILEKKEPELTQEEIDHIAWIQSLAQQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYERSSPLLESVEEPILEKKEPELTQEEIDHIAFIQRLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADFEKSFDQEVAYDRSSPLLESVEEPILEKKEPELTQEEIDHIAFIQRLAEQSSFEQAAPPTRPPVPQRMATVEKPIATTDLHEEDRSSATSGADFEKSFDQEVAYERSSPLLEYVDNPDSVRKEEVDRLAFVDRNVTRNEDEEEQLSNMSSPTDEDHVYDRTTPLLFSDQDSFEKEFAVNASNQCHVEDNWANFGDTSAIPCVDWPTTASFQKSQTGFEQPISSVVRKKSSWDHSVILKEDAIAEEDECVVSGDLPPVKENVTSYWKKSSIPIVRIECVSDDKLHSDNFESVQLLSEDSEKSSDKIETTGQNELVQSADLLEDDLEDELSDHEELKHCSSQYSFDASLPPFHQYAACPSITPSEGDEGRLSDTGAPVSDDIYNEEVNRQIEELSTLATLSKTALPVVEIRIDEATSESSAQQLDDESDATSVADQDGSLADGELTQDEWEHTEAIGNQGNFAIHSCESSVKNIEQIFDTPDLTEYELTHIARIAAMAGEDFEEPLRTPQPKIILPSPTALEKSELTQEEQDHNERIAAMAAEDFKSSIPVEQSVQVSSEPVLTEEEQRHIERVAAMAADDFHASTFFSSKPPQLSEPELTAEERSHIERIAAMANQDFPPSMIVKKPYAVEPELTQEEIDHIDRIAAMASEDSKQPHLVPPSQPQPVEFELSQEEKEHIARITSMAEDFSVPIVNTAATVIEHPEPDLTQEEKDHIARITELANQDFVITKKVSESYVPSEPELTQKEIDHIAKIAEMAAIDCGHFSSTFQESFRNAPVQEQPSGDDPSRTSEIDHILDDLRYSEVTTAYAEHQFPISPEVYVRVSCTDGIKENASHDVEANQSSASTKTSSSAEIVQEATTVTYKKENVSLNGADIEKSFDQGFGYGRSSPLLETAEEPILEKKEPELTQEEIGYISQHPYLFEQSSFEQIAVPITPVVISDDKEDFSSHQKKYETDEEDLKQTKLDHTVKMNAVSEEDYLISAQEYTRANFGKEKQFDLERSDSGDRSSATSGADTEKSFDEDSSLQRSTPYLEHVQQSFIVKKEPELTQEELDHIARIQSLAEQSSFDQVIEAVAPSSDANRSGSSHQEEGRSSSVRSSDYLDTVTPLSSCAATPILTNPKLVQEELDHIAFVQKMAEHFTFEDVETPILTKKTTSHSVSDNFVSRERDESGIKQLESPVLSPVNEYNGAELTQEELDHIAKIQEMANLSSFEAVCSPVQFDLESAGEPSESIKQNLNTSTNIEEKQSFPSPSFAITMENTTRLNNQLSEDQSSSTSGADMERSIDFDQNTSYEYFGYEPSQPIIVEQVEQNNYAESPTRIEDPSDSKFLTTAEMSKHVKKEISEDRSSATSAADSHRSFDSELTEYREYVDQDKQIEGDEQLLTQEELDHIAMVQRMAEQSSFEQFGEQTVVNESIEKPKSEENNSSATSGADVPSSFDVLSPIPPEPLDDHDTTVQRLATDASIEISNLANNAAVSEQPSIVFQTSREHSSATSGADIERSFDGISPLPNFNESPEMTCDEMNYVLMVTHMAETVAIPALQMEKSTIRQGILPQTSEDLSDVTSGADTKRTSSISETEAKRNSDQSNGLTEEELKHIAEVLRKAEASSAASGMFERDSNLPPLRRTSITYTSHFSPSVIRDLRSSTSFSSAPVTTEEKEEEGTKPKLKREPSTQVVYTDHFLRDLQSINASLEKGEDDTDVAIEEISNDRDNASSPLPEEDEMITDVYQFDTGTSLHVQQYVMQQSTFQEASGLHLSPIRRTMSAACTAEKHIDEAENIKEREVKHAQSHDQIKKRAEGEPNAYELLEQHSFRHTQPLLCNVDFLWRGLVENCVPTIGMWLTHGLDISPTLMILELTKKRKKSQNRNFLNFHVFSYSSTFRSSGADSRASNDSSASRLPDNALVGLSEIEKQHIMSVISRSNRNTSPMTSRRCSSALQMLPEVDNISEAEKEHIQNILEKAESRTPFMIKIPMKKQISSRTESTNSRVSSEGIDEEVEIEDQRKKAIEEPIMEIPSRAVTPRNNLRVIPPPIAISHPTPPHSAKTDTGSRHSSGSSAHSQFGFNTPLISGFKIFFDKAKTATETLVKEIKDEVYLPEQEKEKIETTKVETEPSGELTSEELEHIRKINEMAQFDEPNQPVALVQERRKSSVVSGIKNIFGVGKPEEPELTEHEKDHIRRMSLLADKLNEEFEVVDEQLKPKTPKGFGLKSFFGKATQSVMQATDTVMKNVQQHQQKQSLGGLTQEELDQIANAAESAQQEAIKEVTQEELDHIARIAAMAAEDFKYPEQSMEPVLSKAEKDHIARIAAMAGEDFEEPLRTPQPKIILPSPTALEKAELTQEEQDHIAMIAAMAAEDSTSPYPLDRTQMIPHSREPEITEEEREHIARIAAMAAEDFKSSIPVEQSVQVSSEPVLTEEEQRHIERVAAMAADDFHASTFFSSKPPQLSEPELTAEERSHIERIAAMANQDFSTSMIVKKPYAVEPELTQEEIDHIDRIAAMASEDSKQPHLVPPSQPQPVEFELSQEEKEHIARITSMAEDFSVPIVNTAATVTKHPEPDLTQEEKDHIARITELANQDFATTKQVSESYVPSEPELTQEEIDHIAKIAEMAAMDFTVSTIAPQRPVEPELTQEELDHIARIAALPSSENIVPMKPSEPELTKEELDHIAMITAMAEMNDPLPVATRPMAPAAQAPPPPEYFEPELTQEELDHIAKIAEMADMDSRVPVATTYVDYDEEPKTESGSDVTSGADQFNEQDSGSDPGSFNEDNGAQVLTRSFSPDRVTSSPALDTTEEPQSPIMAQKEISSSASADSMASRKSSEYDIRSIEEIRRESESDIGKWYEEQLSFMRQSIHDEEEDTGHEIPVDVEEFPLEYVEDQLHFLDGIAVESHHHQDPTSSSPFSSSFFAGTTGRSIGEECYGNEEKRKNGGGAVEKKVEHQEGEEEEKTKKNSSREDFDDALETQRGESVRAQQTPIDSVPGSRMLKRPNFGFLSNIANDAINKAKEAGSQIQAAVPIKPSTSTANIVNNNVFSNSRSSTSLGTSAPSKSIPSPQIDIPMDGLSEEERRQIMSVMAAADFDDSVNNAKPSTSGSSNIPAGMDDLSEEERQKIMSVMANAEMEMGPPFQTSSQLSTRSPSVMSASMMSEVPTGLEHLSEEERMKIMSVMAEADSQDIRQPMMAPRGPPPMPPSTSMIPPGMEGLSEEERQKIMSVMANAEMDTSNSVISSRQPSRSPSVARIQPPTVAPPPAMPNILPGLEGLSEEERQKIMSVMADAEFDESRSQVPSRQPSRSPSFARSQPAFPPIPSFQTMPMIPPGLEGLSEEQRQKIMSVMMNAEVEESRSQLPSRQHSRSPSYISMQQPTMPMIPPGMEDLSEAEIQKIMSVMAEAEVQNLGPSRSPSGYSMPPAPVIPPGLEDLSEAERQKIMSVMAEAEIDSARIPSRSPSSYSVLPLPPVMRSVHIFESIYFYNSFYFSQPDISTGLEDLSESERQKILSVMAEAEIDSARIPSRSPSSTQIIPPGLEELSEEERKKIMSVMANAEMEETRRSVEQPMALPRGHSGFIPSGVVNEDELFEAERKQREESPTRESGYATSTSYERELAMGGDEQMDGILEDILRIREGARSRRDSRDEVLQRREEDPEVHTPEEVPAPAPTTSSIPTAPSSVPTTVQVSAKPTDDFDFTYSDSRFAEIVKMQEEEEANSIQAAKTDGKPRMWETVFDGDESELPHQDYVFNDSTTKKTSDFDFPKETDEVFEKPSEIQRIRVTKNHDVDMDEIYDNVIATAAPRQQIDNSVKSKTMQRTPSKPPPMIKITGDEEAKSDSDEESCSEDDEEYPDRVVSAPTAPAPSFEEVENERIRQEELGKEVLQQIQAFGEVANDEFDVQWARTTTSQTPSTSTKPVVTAPKRSEPIPIAPSKRSQEIEEERIRTEAIEEEEFYRHGHNPFLESPDEEEVVS"
     misc_feature    <4735..5634
                     /gene="Cre-tag-80"
                     /locus_tag="CRE_12524"
                     /note="104 kDa microneme/rhoptry antigen; Provisional;
                     Region: PTZ00449"
                     /db_xref="CDD:185628"
     misc_feature    <6409..7308
                     /gene="Cre-tag-80"
                     /locus_tag="CRE_12524"
                     /note="104 kDa microneme/rhoptry antigen; Provisional;
                     Region: PTZ00449"
                     /db_xref="CDD:185628"
     misc_feature    <7531..8580
                     /gene="Cre-tag-80"
                     /locus_tag="CRE_12524"
                     /note="104 kDa microneme/rhoptry antigen; Provisional;
                     Region: PTZ00449"
                     /db_xref="CDD:185628"
     misc_feature    <9355..10254
                     /gene="Cre-tag-80"
                     /locus_tag="CRE_12524"
                     /note="104 kDa microneme/rhoptry antigen; Provisional;
                     Region: PTZ00449"
                     /db_xref="CDD:185628"
ORIGIN      
atgtcttcgtggttttcttactttggattcagtaaaggacctcctctcgaagaggtgacggaggaatccgaggaagaagaaactcaagtgcccgaacatgttgtgcctaaaaccgccgaagaagaattggcggaagcaatgaatcggttgtctccagagcaacaaagtatgattcaagatgtgctgagacgagcagaaaactcgagaaaagaagcaaaagtagttgtcgatgcagaaatgatgagatcaagatacagacaaagagaatcaatcgaaggatcacaagatattgatcatcgatattcattggttcaaatggattcaatacctgaaaatatggtaacaaatgaaatggaagaaagagcagcttctcagagagaattcatgcatgaatcaagtcagaaaagtccaataagtccgaatgtaacaagaaaattacatgaaaaacgaccatcaattactgaaggtatttcttccgttgtttttaaaaacttcgtcattttttctaattcagccacaactgaaagtctacgaaatagattccaaaagatgaaatctcatctaacaacttggttcaattcacttgattatgacggagaatacacatttgattttacgagtaaacacgataaatcggagaaactcagtgaccttactatgcaatatattgatgctttgagtcaggcaataatgatatcatctcatattgaatattcacattacttgctatcctcgaatcccgatttccacttgatgtgtactaatttctgtgaatcgatattcaatttggcattcgatgatttggctgatcaaaccgtagatgaaaacgtgagagacaagttgaatgatttctgtggtcgaattgcggaagaagctcttcaatctgctttcttcatgatggtatcaaaaacgttatcgtcttccaaagatagtttcagatgcgaaaatatcatcaatgaaatatccctgttgcacaaatcaaggtctttcgagagtgctcagcaactagatcagtttttgagtaaaatagagaacgaagatgaagatcgggaatctagtagaaaatcatcaccatatatgtacgaagtgcttggaacgtcatctgaaagtccatcatcatcttcatcatatgagtttaaatcacaaaattcttacgagtcagaagtatcaaacgaaaccccgaatgttcacgttgaagaattgtttgatctccaaccgtacgatacatacaaaaccgatgatgacgaggaagtgttccggtctgagaacatactttttgaatgctcgcagacatcaactccagacaacagtctaaaagaaaaaacagaagaggctacttcgttcatgactccaggcgaagaacactatatttggatttctgggccacttggaaggataaacgaagaacatgaacatgacgatgaagatgacgaagttcagaccgagagtagctcagacagcatgataatgcatgagaactcttccgagccaataatgcaattgaatgtcgaagaatacatccaaacaatgattgaaaaagtttctgatccatcattttccgaaaacaccaatgaaacgtataatgaagtgccctgttgttcaaccgaagacgaagaaaccagaaagatacatgaaaccgccaagattctcgtgcaagaaactatggaacaactgatttatgacagtccaacagaatttgaaaaacgagtaaacacgccagaacatcatgaagcagacagatccagtgcaacatcaggagctgactttgagaaatccttggatcaagaagtcgcttatgatcgatcttcacctttcttggaacctgtcgaagagccgattttcgaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcggtcatcattcgaacaagcagcacctccgacacatccaccagttcctcaaagaatggcaacagttgaagaaccaattgctacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctcactttgagaaatcattcgaccaagaagtcgcatacgaacgatcttcacctttgttggaatctgtcgaagagccgattttcgaaaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgacagatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgaacaatccttcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcgaaaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaaagcttggcacagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaacaatccttcgaccaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgatgttggaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgatttggaacaatccttnnnnnnnnnntcgcttggattcaaagcttgcagcacctccgactcgtccaccattgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaacaatccttcgaccaagaagtcgtttatgatcgatcttcacctttgttggaacctgtcgaagagcccattctggagaagaaagaacctggactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacatcagttatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgactttgagaaatcattcgaccaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgatgttggaaaagaaagaaccggaattgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaatagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaaaaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcaaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaaaaatggcagcagtagaagaaccagttgttacgaccgatgttcatgaagaggacagatccagtgcaacatcgggagctgacatcgaacagtccttcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattctcgaaagaaagagcggaactgactcaagagagattgatcacatcgcttggattcaagacagatccagtgcaacatcaggagctgacttcgaacaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgatggaatctgtcgaagagcccattctgggagaagaaagaaacccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacttccgactcgtccaccagttcctcaaagaatggcaacagttgatgaaccggttgcaatgaccgatgttcatgaagaggacagatccagtgcaacctcaggagctgacttcgaacaatccttcgatcaagaagtcgcttacgaacgatcttcacctttgatggaatctgtcgaagagcccattctggagaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgatgaaccggttgcaatgaccgatgttcatgaagaggacagatccagtgcaacatcgggagctgatttggaacaatccttggatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttggaaaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacatcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaacaatcattcgaccaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgatgttggaaaagaaagaaccggaattgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaatagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaaaaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgatgagccgattttcaaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaaaaatggcaacagttgaagaaccagttgttacgaccgatgttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaaaaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcaaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatgttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaaaaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcaaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacttccgactcgtccaccagttcctcaaagaatggcaacagttgatgaaccggttgcaatgaccgatgttcatgaagaggacagatccagtgcaacctcaggagctgacttcgaacaatccttcgatcaagaagtcgcttacgaacgatcttcacctttgatggaatctgtcgaagagcccattctggagaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgatgaaccggttgcaatgaccgatgttcatgaagaggacagatccagtgcaacctcaggagctgacttcgaacaatccttcgatcaagaagtcgcttacgaacgatcttcacctttgatggaatctgtcgaagagcccattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccggttgcaatgaccgatgttcatgaagaggacagatccagtgcaacatcgggagctgacttcgagaaatcattcgaccaagaagtcgcttatgatcgatcttcacttttgttggaacctgtcgaagagccgattttcaaaaagaaagaaccggaactgactcaagaagagattgatcacatcgcttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgatttagaacaatccttggatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttggaaaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaacgtctagctgagcagtcatcattccaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgagaaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgattttggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaacgtctagttgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaacaatccttccaccaagaagtcgcttatgatcgatcttcacctttgttggaatttgtcgaagagcccattttggaaaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaacgtctagttgagcagtcatcattcgaacaagcagcacttccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccaaagccgattctggaaaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaacgtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcgggagctgacttcgaaaaatccttcgaccaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaacgtctagctgagcagtcatcattcgaacaagcagcacctccgacttgtccaccagttcctcaaagaatggcaacagttgaagaaccaattgctacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgaacaatccttcgaccaagaagtcgcttatgatcgatcttcacctttgttagaacctgtcgaagggcccattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcttcaaagaatggcaacagttggagaaccggttgttacgaccgatcttcatgaagaggacagagccagtgcaacatcaggagctgacttcgaacaatccttcgaccaagaagtcgcacacgaacgatcttcacctttgttgaaatctgtcgaagagccgattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttttattcaacgtctagcggagcagtcatcatttgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccaattgcaatgaccgatcttcatgaagaggacagagccagtgcaacatcaggagctgacttcgaacaatccttcgaccaagaagtcgcttatgatcgatcttcacctttgttagaacctgtcgaagagccgattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcttcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgagaaatcaatcgatcaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgattctggagaagaaagaacctgaactgattcaagaagagattgatcatatcgcttttattcaacgtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcaagaaatcattcgaccaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagcccattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaacgtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgctacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgaacaatccttcgaccaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgattctggagaagaaagaacctgaactgactcaagaagagattgatcacatcgcttggattcaaagcttggcacagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgaaaaatccttcgaccaagaagtcgcttacgaacgatcttcacctttgttggaatctgtcgaagagccgattctggagaagaaagaacctgaactgactcaagaagagattgatcatatcgcttttattcaacgtttagcggagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacttcgagaaatcattcgatcaagaagtcgcttatgatcgatcttcacctttgttggaatctgtcgaagagccgattctggagaagaaagaacctgaactgactcaagaagagattgatcatatcgcttttattcaacgtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttccacaaagaatggcaacagttgaaaaaccaattgctacgaccgatcttcatgaagaggacagatccagtgcgacatcaggagctgacttcgagaaatcattcgaccaagaagtcgcttacgaacgatcttcacctttgttggaatatgtcgataatccagattcggtccgtaaggaagaagtcgaccgtcttgcatttgtagatcggaacgtaacgcgaaatgaggatgaagaagaacaactgtcaaacatgtcttctccaactgatgaggaccacgtctacgaccggactactccgctgttgttctcagatcaagattccttcgaaaaagagtttgctgtcaacgcaagcaatcaatgccacgtggaagacaactgggcgaatttcggagacacttcagcaattccttgtgttgattggccaactactgcttcttttcaaaaaagtcaaactggttttgaacaacctatctccagtgtagtccgtaagaaaagtagttgggatcacagtgtcattctaaaggaagatgctatagcagaagaagacgaatgtgttgtatcgggagatttacctccagtaaaggagaatgtaacaagttactggaaaaaatcctccattccaattgttcgcattgaatgtgtttcagacgataagttgcacagtgataactttgaatccgtccaattactaagtgaagattctgaaaaatcgtcagataaaattgaaacgactggtcaaaatgaacttgtgcaaagtgctgatttattagaagatgacttagaagatgaactgtcagatcatgaagaattgaagcactgttcctctcaatattcgtttgacgcttcacttcctccattccatcagtacgcggcttgtccttcaattacaccgtcggaaggagatgaaggaaggctatctgacacgggagcgccagtttctgatgatatttataatgaagaagtgaacagacaaattgaagaactgtccacgctggcaaccttatcaaaaactgcattacccgtcgttgagatcagaattgacgaagccaccagtgaatcatctgcgcaacaattagatgacgagtctgatgcgacgtcagtggccgaccaagatggatctctggctgacggagaattgactcaagatgaatgggagcatacagaggcaataggaaatcaaggaaactttgctatccattcttgtgaatcgagcgtgaagaatatagagcagattttcgacacaccagatctgaccgaatacgagctaactcatattgctagaatagcggccatggcgggtgaagattttgaagaacctcttcgaacaccacaaccaaaaatcatacttccatcaccgacagctttggagaaatcagaactcactcaggaagaacaagatcacaatgaaagaattgcagcaatggctgctgaagatttcaaatcatcgattcctgttgaacagtctgttcaagtctcatctgagccagtattgacggaagaagaacaacgacatattgaaagagttgctgcaatggctgctgatgatttccatgcttcgacatttttctcttctaaaccacctcaactttcagaaccggaattaactgcagaagaacgatctcacattgaaagaatagctgcaatggcaaatcaagactttcctccatcaatgatcgtcaaaaaaccatacgcagttgaaccagaactgacacaagaagaaatagatcacatcgacagaatcgctgcaatggcatctgaagattccaaacaacctcatctggtacctccatcccaacctcaacccgttgaatttgaactctcgcaagaagaaaaagagcacattgccagaattacttcaatggcagaggacttcagcgtgcctatcgtaaataccgcagctacagtaatagagcaccctgaaccggatctaacccaagaggagaaagatcacattgcaagaataaccgagttggctaatcaagattttgttataaccaagaaagtttccgaatcatatgttccatctgagcctgaattaacacaaaaagagatcgatcacattgcaaaaattgcggaaatggctgcgattgattgtggacatttttccagtacatttcaagaatctttccgaaatgcacctgttcaagaacaaccttctggtgatgatccttcaagaacttctgaaattgatcacattttggatgatcttcgttactctgaagttactactgcttatgctgaacatcagtttccaatatcacctgaagtttatgtacgagtttcttgtacagatggaatcaaagaaaacgcatcgcatgatgtcgaagctaatcaatcatcagctagtactaaaacaagtagttcagcagaaatcgttcaagaagcaacaactgtcacatataaaaaagagaatgtatcattgaatggagctgacatcgagaaatcattcgaccaaggattcggttacggccgatcttcacctctgttggaaactgccgaagaaccgattctggagaagaaagaaccggaactgactcaagaagagattggatatatttctcaacacccatatttgtttgagcagtcatcattcgaacaaatagccgttccgataacacctgttgttatttctgatgataaagaagatttcagtagtcatcagaaaaagtatgaaacagatgaagaagatttgaaacagactaagctggatcatactgtaaagatgaatgcagtgtctgaagaagattatcttatttccgctcaagaatataccagggcgaacttcggcaaagaaaaacaattcgatttggagagaagtgattcgggagatagatcaagtgctacttcgggtgctgatacagaaaaatctttcgacgaagattcatcattacaacgttcaacgccctatcttgaacatgtacagcagtcgtttattgttaagaaagagcctgagcttacacaggaagagcttgatcatatcgctcgaatacagagccttgctgagcaatcatcattcgatcaagtaattgaagctgttgctccgtcttcagatgccaatcgatccggtagttcgcatcaagaagaaggaaggtcgagttctgtcagatctagtgattatctagatacagttacacctttatcttcttgcgctgcaacaccaattctgacaaatccaaaacttgttcaagaagagcttgatcacattgcctttgttcaaaaaatggctgaacatttcacttttgaagatgtcgaaacaccaattttaaccaagaaaacaacatctcatagtgtcagtgataactttgtttcaagagaacgtgatgaatctggtatcaaacaacttgaatcacctgtactttctccagttaatgaatataacggagcagagctgactcaagaagagttggaccatattgcgaaaatacaggagatggcaaatctgtcatcatttgaagccgtttgtagtccagtgcaatttgatctagaatcagccggagaaccatcagaatccattaaacagaatctaaacacatcaaccaatattgaagaaaagcaatcgtttccaagtccttcatttgctataacaatggaaaacaccactcgtctcaataaccaactatcagaagatcagtcaagctcaacatctggagcagatatggagagatcaatcgacttcgatcaaaatacttcatatgaatattttggttatgaaccaagtcaacctatcatagttgaacaagttgagcaaaacaattacgcggaatccccaactcgaattgaagacccatctgattcaaagttcttaacgactgcagaaatgagcaaacatgtgaaaaaagaaatatcagaagatagatcaagtgccacatcagcagcagattcccatcgatctttcgattcggagttaacggaatatcgtgaatatgttgatcaagacaagcaaattgaaggagatgaacaactactaacacaagaagagttggatcacattgcaatggtacagagaatggcggagcaatcgtcgttcgagcagttcggagaacagacagttgtaaatgagagtatcgaaaagccaaaatctgaagagaacaactccagtgcaacttcaggagctgatgttccatcttcattcgatgttttgtctccaattccaccagaaccactggatgatcacgatacgactgttcaaagattagctaccgatgcttcaatcgaaatttcaaatttggctaataatgctgctgtttctgaacaaccatcgattgttttccaaacatctcgagaacattcaagtgcgacatctggagctgacattgaaaggtcatttgacggaatctcaccacttcccaattttaatgaaagcccggaaatgacgtgcgatgagatgaactatgttctaatggtcactcatatggcagaaactgttgctataccggcacttcaaatggagaaatcaacaatcagacaaggtattctacctcaaacatcagaagacttgtctgatgtaacatctggagccgatactaaaagaacatcttcaatatcagaaacggaagcgaaaagaaatagtgaccagtcgaacggtcttaccgaagaagagctgaaacatattgctgaagtactaaggaaagcggaagcctcatctgcagccagtggaatgtttgaaagagattcgaatctcccgccactacgaagaacctcaatcacttacacttctcatttctccccttcagttattcgagatctcagatcatcaacatcattctcttctgctcctgtcacaacggaagaaaaagaagaagaaggaacaaaaccgaagttgaagagagaaccaagtactcaagttgtatacaccgatcacttcctacgagatcttcaatcaataaatgcatcattagagaaaggagaagatgacaccgacgtcgcaattgaagaaatcagtaacgatcgagataatgcaagttcaccactcccagaagaagatgaaatgatcacagatgtttatcaatttgatactggaacatcccttcatgttcagcaatatgtaatgcaacaatcaactttccaagaagcttcaggccttcatttatctccaattcgacgaacaatgagtgccgcatgcacagccgaaaaacatatagacgaagcagagaatataaaagaaagagaggttaagcatgctcaaagccatgatcaaattaagaagagagctgaaggagaaccaaatgcttatgaacttcttgagcaacacagcttccgtcacacacaaccgcttctctgtaatgttgatttcctttggcgtgggctggtagagaattgcgtgcccactatcggaatgtggctaacccacgggctagatatttctccgacgcttatgatattggaactgacgaagaagaggaagaagtcgcagaaccgcaattttctgaactttcatgttttctcttattcatctacttttagatcgtcgggtgcagactcaagagcttcaaatgacagttctgcttctcgtctacctgataacgctttggttggtttatctgaaattgaaaaacaacacattatgtctgtcatttctcgttcaaacagaaacacttcacctatgacttcaagaagatgttcttctgcattgcaaatgcttcctgaagttgataatatatctgaagctgaaaaagagcatattcaaaacattctggaaaaagctgaatcaagaacaccatttatgataaaaattccaatgaaaaaacagatttcgtcaagaactgaatcgacaaattctcgagtttcaagtgaaggaattgacgaagaagttgaaattgaagatcaaagaaagaaggctatcgaagagccgattatggaaattccatcgagagcagtgactccgagaaataatttgagagttattccacctccaattgcaatttctcatccaacacctcctcattcagcaaaaacagatactggatcaaggcatagcagtggatcatcagctcactctcaatttggcttcaatactcctttgatttctggattcaaaatattctttgataaggcgaaaacagcaacagaaacacttgtcaaagagataaaagatgaagtttatttgccagagcaggagaaagagaaaatagaaacaacaaaagtagaaacagaaccaagtggagaattgacttcagaagaactggagcatattagaaaaatcaatgaaatggctcagtttgatgaaccaaatcagccggtggctctagtccaagaacgtcgaaaatcaagtgttgttagtggaataaagaacatattcggagttggaaaacctgaagaaccggaattgactgagcacgagaaggatcatatcaggagaatgtcactgttagctgataagttgaatgaagaatttgaagtagtggatgaacaattaaaaccaaaaacaccgaaaggattcgggttgaagagctttttcggaaaagcaactcaatctgttatgcaagctacggatactgtgatgaagaatgtacaacaacatcaacagaagcaatcacttggaggattgacacaagaagaacttgatcaaatagctaatgcagctgaaagtgcacaacaagaagcaataaaagaagttacgcaggaagaattggaccatattgctaggattgcggcgatggctgctgaggatttcaagtatccagaacagagcatggaaccagtattatctaaagcagaaaaagatcatattgctagaatagcggccatggcgggtgaagattttgaagaacctcttcgaacaccacaaccaaaaatcatcctcccatcaccgacagctttagagaaagcagaactcactcaggaagaacaagatcacattgcaatgattgcagcaatggctgctgaagattctacatcaccttatccactcgaccgaactcaaatgattccacactcacgggaacctgaaataactgaagaggaaagagaacacattgcaagaattgcagcaatggctgctgaagatttcaaatcatcgattcctgttgaacagtctgttcaagtctcatctgaaccagtattgacggaagaagaacaacgacatattgaaagagttgctgcaatggcggctgatgatttccatgcttcgacatttttctcttctaaaccacctcaactttcagaaccggaattaactgcagaagaacgatctcacattgaaagaatagctgcaatggcaaatcaagacttttctacatcaatgatcgtcaaaaaaccatacgcagttgaaccagaactgacacaagaagaaatagatcacatcgacagaatcgctgcaatggcatctgaagattccaaacaacctcatctggtacctccatcccaacctcaacccgttgaatttgaactctcgcaagaagaaaaagagcacattgccagaattacttcaatggcagaggactttagcgtgcctatcgtaaataccgcagctacagtaacaaagcaccctgaaccggatctaacccaagaagaaaaagatcacattgcaagaataaccgagttggctaatcaagattttgctacaaccaagcaagtttccgaatcatatgttccatctgagcctgaattaacacaagaagagattgatcacattgcaaagattgcggaaatggctgctatggacttcacagtttcaacaattgctcctcaaagacccgttgaaccagaattaacacaagaagaacttgaccatattgctagaattgctgccctgccttcatctgaaaatatcgttcccatgaaaccatcagaaccagagttgaccaaagaagaactggatcatattgctatgataactgcaatggctgagatgaatgacccacttcctgtcgccacaagaccgatggccccagcggctcaagctcctcctcctcctgaatattttgagccagaactcactcaagaagagctcgaccacattgcaaaaattgctgagatggctgatatggattcacgtgtaccagttgctacaacctatgttgattacgatgaagaaccgaaaacagaaagcggatcagatgtgacatcaggtgctgatcagtttaacgaacaagattccggatcggaccctggctccttcaacgaagacaacggtgctcaagtgctaacaaggagcttctctccagatcgagttacatcttctcctgcacttgacacaactgaagagccccagagtcctattatggctcagaaggagatttcctcgtcggcatcagcagattctatggcgtcacgaaaaagcagtgaatatgatattagaagtattgaggagataagaagagaatcagaatcagatattggaaagtggtacgaagaacaactcagtttcatgcgacagtctattcatgatgaagaagaagatactggacatgaaatccctgtcgatgttgaagagttcccacttgaatatgttgaagatcaacttcatttccttgacggtattgccgtggagagccaccaccaccaggaccctacttcttcttctcctttttcttcttcttttttcgccggcaccaccggaagatcgattggtgaagagtgttatggcaatgaggaaaagagaaagaatggtggtggcgctgtggagaaaaaagtggagcaccaagaaggggaagaggaggagaagacgaagaagaatagtagtcgtgaggattttgatgatgcattggagacgcagagaggggagtcggtgagggcgcagcagacacccatcgattcggtgccgggtagtcgtatgttgaagcgacccaatttcggcttcctctctaatattgcaaatgatgctattaataaagcgaaggaagcgggctcgcaaatccaagccgccgtacccatcaagccatcgacatctacggcgaacattgtgaataacaatgtcttctctaacagcaggtcttcaacctccctaggcacaagtgcaccctccaaatctatcccatcacctcaaattgacattccaatggatggcctctcagaagaagaacgtcgtcaaataatgtccgtgatggctgctgctgactttgacgactctgtcaacaatgcgaaaccaagcacaagcggttcatcgaatattccagcaggaatggatgatctttctgaagaagaacgacaaaagatcatgtcagttatggctaatgctgaaatggaaatgggtccaccattccaaacgtccagtcaactttcaacaagatctccaagtgtgatgagtgcgagtatgatgtcagaagtgccaactggattggaacatttatcagaagaagaaagaatgaagataatgtctgtgatggctgaggctgatagtcaagatatacgacaacctatgatggcaccacgaggaccacctccaatgcctcctagcacatcgatgatcccgccgggtatggaaggtctatcagaagaagaacgtcagaagatcatgtctgtaatggcaaatgctgaaatggatacatcgaatagtgttatttcttcgagacaaccgagtagatcacctagtgtcgctagaatacaaccaccaacagtagctcctccaccagcaatgccgaatattcttcccggattggaaggattgtcagaagaagaacgtcagaagattatgtcagttatggcagatgcagaatttgatgagtcaagaagtcaagttccgtcaagacaaccaagtcggtcgcctagtttcgcaagatctcaaccagcattccctccaattccatcgttccaaacaatgccgatgattccacctggattggaaggtctatcagaagagcaacgacagaaaatcatgtcagttatgatgaatgcagaagtagaagaatcgagaagtcaactaccatccagacaacatagtcgttcacccagctatatcagcatgcaacaaccaacaatgccaatgattccacctggaatggaagatctatcagaagcagagatacagaaaatcatgtcagttatggcagaagcagaagttcaaaacttgggaccaagtcgatcaccaagcggttattctatgccaccggctccagtgattcctccaggattagaagatttatccgaggctgaaagacaaaagattatgtctgttatggctgaagctgaaattgattctgcgaggattccgagcaggtctccgagcagttactcagtcttaccactaccaccggttatgaggtctgtacatattttcgaatcgatttatttctataactcgttttatttcagccagccagatatctcaacgggactagaagatctttccgaatctgagcgtcagaaaattctttcggttatggcagaagctgaaatagattctgcaagaattccgagtagatcaccatcatccactcaaataattccacctgggttggaagaattatctgaagaagaacgaaagaagataatgtcagtaatggcgaatgctgaaatggaagaaacaagaagatccgtagaacaaccaatggctcttccacgtggtcattccggatttattccatctggagtagtaaatgaagacgagctttttgaggcagaaagaaaacaaagagaagaatctccaacacgagaatctggatatgccacgtcgacatcttacgaacgagaattggcaatgggtggcgacgagcaaatggatggaatattggaagatattcttcgaattcgagaaggtgcaagatcaagaagagatagtcgagatgaagtattacaaagaagagaagaagatccagaagttcatactccagaagaagttcctgctcccgcaccaaccacttcttcgataccaacagctccatcttcagtgccgacgactgtacaagtttcagccaagccaacggatgatttcgatttcacatattccgattcaagatttgctgaaatcgtgaaaatgcaagaagaggaagaagctaattcaattcaagctgcaaaaactgatgggaagccacgtatgtgggaaacagttttcgacggcgacgaatcagaattgccccaccaggactatgttttcaacgactcgacaacaaagaaaacgtcagattttgatttccccaaggagacggacgaagtctttgaaaagccctctgagattcagagaattcgggtcactaaaaatcatgatgttgatatggatgagatctatgacaacgtgattgcaactgctgctccaagacaacaaatcgacaactctgtaaaatcaaaaacaatgcaaagaacaccttcgaaaccacctccaatgatcaaaataacaggagatgaagaggcgaaatcagatagtgatgaagagagttgttcagaagatgatgaagaatatccggatagagttgtgtctgctccaacagccccggctccgtcattcgaagaagttgaaaatgagagaataagacaagaagagttaggaaaggaagttttacaacagattcaagcattcggagaagtggcaaacgatgaatttgatgttcaatgggctagaacaacgacgagtcagacaccaagtacatcaactaagcctgttgtaacagctccgaaacgaagtgaaccaatccctattgcaccatcgaaacggtcacaggaaattgaagaagagagaataagaactgaagctatcgaggaagaagaattctatcgacacggtcataatcctttcttagaatctccagatgaagaagaagtggttagttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]