2021-01-24 05:58:32, GGRNA.v2 : RefSeq release 203 (Nov, 2020)
LOCUS XM_003107282 2583 bp mRNA linear INV 13-OCT-2010 DEFINITION Caenorhabditis remanei hypothetical protein (CRE_14480) mRNA, complete cds. ACCESSION XM_003107282 VERSION XM_003107282.1 KEYWORDS RefSeq. SOURCE Caenorhabditis remanei ORGANISM Caenorhabditis remanei Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 2583) AUTHORS Wilson,R.K. CONSRTM The Caenorhabditis remanei Sequencing Consortium TITLE PCAP assembly of the Caenorhabditis remanei genome JOURNAL Unpublished REFERENCE 2 (bases 1 to 2583) AUTHORS Wilson,R.K. CONSRTM The Caenorhabditis remanei Sequencing Consortium TITLE Direct Submission JOURNAL Submitted (17-JUL-2007) Genome Sequencing Center, Washington University School of Medicine, 4444 Forest Park Parkway, St. Louis, MO 63108, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_003319677). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2583 /organism="Caenorhabditis remanei" /mol_type="mRNA" /strain="PB4641" /db_xref="taxon:31234" gene <1..>2583 /locus_tag="CRE_14480" /db_xref="GeneID:9805472" /db_xref="WormBase:WBGene00060691" CDS 1..2583 /locus_tag="CRE_14480" /note="contains similarity to Pfam domains PF02170 (PAZ domain), PF08699 (Domain of unknown function (DUF1785)), PF02171 (Piwi domain); contains similarity to Interpro domains IPR014811 (Region of unknown function DUF1785), IPR003165 (Stem cell self-renewal protein Piwi), IPR003100 (Argonaute and Dicer protein, PAZ)" /codon_start=1 /product="hypothetical protein" /protein_id="XP_003107330.1" /db_xref="InterPro:IPR003100" /db_xref="InterPro:IPR003165" /db_xref="InterPro:IPR014811" /db_xref="PFAM:PF02170" /db_xref="PFAM:PF02171" /db_xref="PFAM:PF08699" /db_xref="WormBase:CRE14480" /db_xref="GeneID:9805472" /db_xref="WormBase:WBGene00060691" /translation="
METALVVPEQKEHELPCIRFRPPKRPNYGRIGREIILRTNYYRMKIVAEKVQHYSVEMSTTMCSRKTNREIFTRFLATYPDHFADMHPVYDGKENMYTKKLLPLDHQNLSVVLLVPVESGGRPRLVTVSVKWVGEISLMSNDNLKYEAIQVIDTILRHVPSLRYATIGKSFYYKPLPDQGLSLGGGREIWMGYHQSTKLTRKGCMLNVDVSAAAFHTAIPVIEFLSKVLDLPENLRISVMEQGITHSQHHQFSKAIKNLYIELAHFPTRSRMRKVINVTEQPADELIIDKNLPDGSTKKCTVAQHFLEQHQITLQYPHLPCLQVGLIEFPSYFPIEVCILADYQRCVKKLTEGQKSQMIWASAKPAPDRMRAISKQRDALEFELDPCVNDFGIQISSNMTELKGRVLRPPSLVYSDNKSPQKDASKSPTDGAWDMRPYKFLDGIHITCWAIACFAEPKEVHEDCLTRYVHLLRKISQESGVPITEYPVFCKYGHGVEEVELVLRFLKETYPDLQLVLVILPGKHDFYPEVKRVGDTLLGVTTQCVQAKNVVKTFAKTAANICLKINAKLGGVNCILNPQHRPQIYNESVIFLGCNVTNITVADTAIQSVVSIVGSMDAYPSKYAATVRVQESQDLIADMAAMVKELLLRFHRNTGFKPSRIVVYRDAALENMFHEILQYELRAIREACKMIEKEYEPGITFIAVMKRHHTRLFAIYPMHQTGQSRNIPPGTTVDSVITHPTQFDFFLCSHAGIQGTSRPTRYYVLWDDNKMPADEMQQMTYQLCHTYVRCNRAVSIPAPAYYAILVCTRAKIHLWEREQDREREGGSEDSARLDLSHLARAVQVSTINSKIVHNSKNFRL"
misc_feature 16..2415 /locus_tag="CRE_14480" /note="protein argonaute; Provisional; Region: PLN03202" /db_xref="CDD:215631" misc_feature 73..468 /locus_tag="CRE_14480" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:293095" misc_feature 499..651 /locus_tag="CRE_14480" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:285861" misc_feature 652..1014 /locus_tag="CRE_14480" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(817..819,862..864,904..906,916..918,970..972, 991..993,997..999) /locus_tag="CRE_14480" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1156..2442 /locus_tag="CRE_14480" /note="Piwi_ago-like: PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1579..1581,1591..1593,1627..1638,1645..1647, 1669..1671,1678..1680,1690..1692,1702..1704) /locus_tag="CRE_14480" /note="5' RNA guide strand anchoring site; other site" /db_xref="CDD:240015" misc_feature order(1783..1785,1789..1791,1996..1998,2410..2412) /locus_tag="CRE_14480" /note="active site" /db_xref="CDD:240015" ORIGIN
atggagacggcactagttgttccagagcagaaagaacatgaactaccctgtatccgattccgaccaccaaaacgtccaaattatgggagaatcggaagagaaattatacttcgaaccaattactatcgcatgaaaatagtagcagagaaagtgcaacattatagtgtagagatgtcgacaacaatgtgctcaaggaaaacaaatcgagaaatcttcactcgctttctagcaacctatcccgaccatttcgctgatatgcatccggtatacgacggaaaagaaaacatgtacacaaagaagctgctcccactggaccatcaaaatctgagtgtcgtcttgttagttccagtggaaagtggaggtagaccccgcctagtgacagtatccgtcaaatgggttggcgagatttcattgatgagtaatgacaacttgaaatatgaggcgattcaagtgatcgatacgattctccgacatgttccgagtcttcgatacgcaactattggaaagtctttctactacaaaccactaccagatcagggtttaagccttggtggtggtcgagaaatctggatgggatatcatcaatcgacaaagttaactcggaagggttgcatgctgaacgtcgatgtttccgctgccgcatttcacaccgcgataccagttattgagttcctgtcaaaagttcttgatctaccggagaaccttcggatctcggtgatggagcaaggcatcactcactcccaacatcaccaattctcaaaagcaatcaagaatctctacatcgagcttgctcactttccaaccagaagtcgaatgcgtaaagtgattaatgtaacggaacaacctgctgatgagttaatcattgacaagaacttacccgatggaagcaccaaaaagtgtactgtagctcaacacttcctggaacaacatcaaataacgctacagtatccccacttaccatgtctgcaagtgggtcttattgaatttccgtcatacttcccgattgaagtatgcatcctggctgattatcaacgatgtgtgaaaaagctgacagagggacagaagtctcagatgatatgggccagtgcgaaaccggcgccggatagaatgagagcgattagtaagcagagggacgccttggaatttgaattggatccttgtgtgaatgatttcggaattcaaatcagttcaaacatgacagaattgaagggacgagtactacgtccacccagtcttgtctactcggataacaaatcgcctcaaaaagatgcttcaaaatctcctaccgatggtgcgtgggacatgagaccctacaaatttttggatgggatccatatcacttgttgggcaatcgcgtgcttcgccgagccgaaagaagttcatgaagattgtctgacgagatatgtgcaccttcttaggaagatttcccaagagagtggtgtgccgattactgaatatcctgtcttttgcaagtatggccatggagtagaggaagtggagttggtgttgaggtttttgaaggaaacgtacccggatctccagttggttcttgtgatattaccagggaagcatgatttctatcccgaagtaaaacgagtcggcgacactctcctaggcgtcaccacccaatgcgttcaagccaagaacgtcgtcaaaacatttgccaagacagctgccaacatctgcctgaaaataaacgcaaagctcggcggagtcaattgtatcctaaaccctcaacatcgtccacaaatttacaacgaatcagtcatcttcctcggctgtaatgtcacaaacataacagtcgctgacactgccatccaatctgttgtctctatcgtcggatccatggatgcttaccccagcaagtacgccgcgacagtgcgtgttcaagaatcgcaagatttgatagcagacatggctgcaatggtaaaagagctacttttgagattccataggaacactggattcaagccgtcaaggatagtagtctatcgtgacgcagctctagagaacatgttccatgaaatactgcaatatgaattgagagcaatacgggaagcctgtaaaatgattgaaaaagaatacgagcctggtatcacatttatcgctgtcatgaagagacatcacactcgtctcttcgcaatataccctatgcaccaaaccgggcagtctcgcaacatcccacccgggactactgtagacagtgttatcactcatccaacccagtttgacttcttcctctgctcccatgcaggaatccaaggaacttcaagaccaactcgctactatgtactgtgggatgacaataaaatgccggcggacgagatgcaacaaatgacttaccaactgtgtcatacttatgtgagatgcaatcgtgcggtgtcgatccctgctccagcgtactacgcaattttggtgtgtactcgggcgaaaattcatctgtgggagcgggagcaagatcgggagagagaaggaggatcagaggattctgcaagattggatctgtcccatttggcacgcgcggtgcaggtgagtaccataaactcaaaaattgtgcacaattcaaaaaactttcgactttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]