GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:27:02, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_003106040            2895 bp    mRNA    linear   INV 13-OCT-2010
DEFINITION  Caenorhabditis remanei hypothetical protein (CRE_20331) mRNA,
            complete cds.
ACCESSION   XM_003106040
VERSION     XM_003106040.1
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis remanei
  ORGANISM  Caenorhabditis remanei
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis.
REFERENCE   1  (bases 1 to 2895)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     PCAP assembly of the Caenorhabditis remanei genome
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 2895)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (17-JUL-2007) Genome Sequencing Center, Washington
            University School of Medicine, 4444 Forest Park Parkway, St. Louis,
            MO 63108, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003319672).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2895
                     /organism="Caenorhabditis remanei"
                     /mol_type="mRNA"
                     /strain="PB4641"
                     /db_xref="taxon:31234"
     gene            <1..>2895
                     /locus_tag="CRE_20331"
                     /db_xref="GeneID:9807515"
                     /db_xref="WormBase:WBGene00061720"
     CDS             1..2895
                     /locus_tag="CRE_20331"
                     /note="contains similarity to Pfam domains PF02170 (PAZ
                     domain), PF02171 (Piwi domain); contains similarity to
                     Interpro domains IPR003165 (Stem cell self-renewal protein
                     Piwi), IPR003100 (Argonaute and Dicer protein, PAZ); coded
                     for by the following C. remanei cDNAs: DR406864, DT935667,
                     DR781777, DR781143"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_003106088.1"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="PFAM:PF02170"
                     /db_xref="PFAM:PF02171"
                     /db_xref="WormBase:CRE20331"
                     /db_xref="GeneID:9807515"
                     /db_xref="WormBase:WBGene00061720"
                     /translation="
MLPLRKTTDQYGVLPPPAVPPPNATITSDSKTANEACIARLQQLQLQPFPKIYPTTKPPGNRGSSVDIQTNVFGIEIQKRSDIYQYSVSIKTDLTSSKEVVFTKKGKEDFVVRERHGKCCSILMHAFDRYSEFFCTNENTLIYDGQSMMYSTFDLFQESSDGETKTKLLPINGNDTDHEDLKSLPYIKLEVHATKNPPVKFSQEDIGRRSSDSRIDSIHGAYHHILELALNQSCIRDFTRCMVFENGKIFFVNPLEEGFSRDDFVDVGDGKQMLPGIKKTVQFIEGPYGRGQSNPSVVIDGMKVAFHKEQPLNEKIREIISKNVTDCISDFERERCVAVIKGLDCYTTHAKRVRHLTIEGIHHEGARKSRFQLKDGGASTVAEYFRDHYKIELRYPNANLVVCKERGNLNFYPMELVFISPNQRVKISQQTSAQSQKTTKESAVLPDVRQRIIMTGKIAAKISSDSKYLNEFGLSVCDEPLMVTGRILPPVKLEGRTSANMLPIKDNKWRLGQYARPAQAPKVWAMYAVGLPSSRFTPALLSKFGDEFSAMCRSKGIEMPALGDIDLVLAQDIEKKLSIAADAGCTFVYIITDDAITNLHQKYKAMESLHSMVIQDMKMSKAHSVVSQGKKLTLENIVNKTNMKLGGNNYIFTDSKKYLDDILVIGVGISQPPPGNKFISEGKGLLNPMVIGFAHNGKQKQEFSGDFVLSPAGQDTLVVVEEVLKQSISGYQKWHDGQCPKRIIMYRSGVSEGSQGNVIAYELPLIRSTIDSFSKKIQFVYIAVSKDHSYRFFKSNLNTLTKSNTAISKGQQSSVTGSRSAMPAAGAPKAWDLNIAPGIIVDSVITNPACSQFFLNSHITLQGSAKTPLYTVLSDDTHASMASLEELTYNLCHLHQIVGLPTSLPTPLYVANEYAKRGRNLWNEAYSRNPVPRGTGSESELLQELSNAINYKAFGSFLDRRVNA"
     misc_feature    178..>495
                     /locus_tag="CRE_20331"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    925..1257
                     /locus_tag="CRE_20331"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1066..1068,1111..1113,1141..1143,1153..1155,
                     1207..1209,1228..1230,1234..1236)
                     /locus_tag="CRE_20331"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1345..1482
                     /locus_tag="CRE_20331"
                     /note="Argonaute linker 2 domain; Region: ArgoL2;
                     pfam16488"
                     /db_xref="CDD:293097"
     misc_feature    1756..2769
                     /locus_tag="CRE_20331"
                     /note="Piwi domain; Region: Piwi; pfam02171"
                     /db_xref="CDD:280353"
     misc_feature    order(1798..1800,1810..1812,1843..1854,1861..1863,
                     1897..1899,1906..1908,1918..1920,1930..1932)
                     /locus_tag="CRE_20331"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:239208"
     misc_feature    order(2002..2004,2008..2010,2242..2244,2734..2736)
                     /locus_tag="CRE_20331"
                     /note="active site"
                     /db_xref="CDD:239208"
ORIGIN      
atgttgcctctgagaaagacgacagaccaatatggagtcttaccgccaccagcagtcccaccgccaaacgcaaccatcacatcggacagcaagactgcgaacgaagcctgcattgcacgtttgcaacagctccagttgcaacccttcccaaagatatacccaacaacaaagcctcctgggaatagagggagtagcgttgatatccaaaccaatgtatttggaatcgaaattcagaaaagatccgatatatatcaatacagtgtttccatcaagactgatttaacgtctagtaaagaagtcgtcttcaccaaaaagggaaaagaagattttgtcgtcagagaacggcatggaaaatgttgttcaattctaatgcatgcattcgaccgttattcggaatttttttgcaccaacgaaaacactctgatatatgatggtcaaagcatgatgtactccacgttcgatctcttccaagagtcatctgatggggaaacaaagacaaagctacttccgatcaatggtaacgatacggaccacgaagacctcaaaagcttgccttatatcaagcttgaagttcacgctactaaaaatccgcctgttaagttttcccaggaagacattggacgacgttcgtctgattcgaggattgactctattcatggcgcttaccatcatattttggaactagctctcaaccaatcttgcatccgagatttcacgagatgtatggttttcgaaaacggtaaaattttcttcgtcaatccattagaagagggcttctctcgagatgactttgtcgatgttggtgatggaaagcaaatgctgcctggaatcaaaaagactgttcagtttattgaaggaccttacggaagaggacaaagcaatccatcagtcgttatcgatggaatgaaagttgcgtttcataaagagcagcctttgaacgaaaaaattcgagaaatcatctccaaaaatgttactgattgcatcagcgactttgagagagaacgttgtgtggcggtcattaaaggtctagattgctatactacccatgctaagcgtgtccgtcatctcacaatcgaaggaatccatcacgagggcgccagaaaatcccgttttcaacttaaagatggtggagcatctactgtagctgaatatttcagagatcattataaaatcgagcttaggtatccgaatgccaatctcgttgtttgtaaagaacgaggaaatctgaatttctatccgatggagctggtttttatatcaccaaatcaacgtgtcaagatttctcagcaaaccagtgcacagagtcagaaaactacaaaggaaagcgcagttttgcctgatgttcgccagcgaattatcatgacaggaaaaattgctgctaaaatttcatcagatagcaaatatctaaacgaatttggactttccgtctgcgacgagccgctcatggtcactggtcgtattcttcccccggtaaaactagagggtcgtacatctgccaatatgcttcccatcaaagacaataaatggcgtctcggccaatatgcacgaccggcccaagctccaaaagtgtgggcaatgtatgctgttggattgccatcaagccgttttactcccgctttgctaagcaagtttggggatgaattttctgccatgtgtagatcaaaaggaattgagatgccagcactgggtgatattgatcttgtcttagcccaagatattgaaaagaagctatcaatcgcagctgatgcgggttgcacttttgtgtatatcataacagatgatgcgatcactaatcttcatcagaaatataaagcgatggagagcctgcattcgatggttattcaagacatgaaaatgtcaaaagctcattctgtcgtcagtcaaggaaaaaaacttactttagagaacatagtcaacaagacgaatatgaagcttggtggtaacaactatatttttacggatagtaaaaaatacctcgatgatattctagttatcggtgttggtatctctcagccaccaccaggcaataaattcatctcagaaggaaaaggtttgctgaacccgatggtcattggtttcgctcacaatggaaagcaaaaacaagaattttccggtgactttgttctgagccctgctggacaagatactctggttgttgtcgaagaagtgctcaaacaatccatttcaggatatcagaagtggcacgacggacaatgtccaaagcgtattatcatgtacagaagtggtgtcagtgaaggaagtcaagggaatgtcatagcatatgaacttcctcttatccgatctactattgattcgttctcgaagaaaatccagtttgtttacatcgctgtgtcaaaagatcatagttaccgtttcttcaagagcaacttgaacactctaacaaagagcaacactgcgatttcgaaaggacaacaatcatctgtaactggaagcagaagtgctatgcccgccgctggggctccaaaagcatgggatctaaacattgctcctggaattattgttgacagtgttattaccaatccagcctgctcacagtttttcctaaactcgcatattactctacagggttccgcgaagacccccctctatacagttttatcggatgacacccatgcatcaatggctagtttggaagagctcacctacaatttatgtcatcttcatcaaattgttggtcttccaacttctctcccaacgccattgtatgtcgccaacgagtacgcaaaaagaggaagaaacttgtggaacgaagcgtactcaagaaatccggtacctcgaggaactggctcggaaagcgaactccttcaagaattgtccaatgccattaactacaaggcttttggaagtttccttgatcggcgtgtaaacgcctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]