LOCUS       XM_003103769            2709 bp    mRNA    linear   INV 13-OCT-2010
DEFINITION  Caenorhabditis remanei hypothetical protein (CRE_09584) mRNA,
            complete cds.
ACCESSION   XM_003103769
VERSION     XM_003103769.1
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis remanei
  ORGANISM  Caenorhabditis remanei
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 2709)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     PCAP assembly of the Caenorhabditis remanei genome
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 2709)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (17-JUL-2007) Genome Sequencing Center, Washington
            University School of Medicine, 4444 Forest Park Parkway, St. Louis,
            MO 63108, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003319658).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2709
                     /organism="Caenorhabditis remanei"
                     /mol_type="mRNA"
                     /strain="PB4641"
                     /db_xref="taxon:31234"
     gene            <1..>2709
                     /locus_tag="CRE_09584"
                     /db_xref="GeneID:9802270"
                     /db_xref="WormBase:WBGene00059681"
     CDS             1..2709
                     /locus_tag="CRE_09584"
                     /note="contains similarity to Pfam domains PF02170 (PAZ
                     domain), PF08699 (Domain of unknown function (DUF1785)),
                     PF02171 (Piwi domain); contains similarity to Interpro
                     domains IPR014811 (Region of unknown function DUF1785),
                     IPR003165 (Stem cell self-renewal protein Piwi), IPR003100
                     (Argonaute and Dicer protein, PAZ)"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_003103817.1"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR014811"
                     /db_xref="PFAM:PF02170"
                     /db_xref="PFAM:PF02171"
                     /db_xref="PFAM:PF08699"
                     /db_xref="WormBase:CRE09584"
                     /db_xref="GeneID:9802270"
                     /db_xref="WormBase:WBGene00059681"
                     /translation="

METEIELASDPTIQLLSAMTSMRVDSGGAPGPPPASATSSLARSGVQFSCPRRPNHGVEGRAILLRANHFSVRIPGGTIQHYNVDVMPDKCPRRVNREIIGCLISSFTRYFTNVRPVYDGKNSMYTRDLLPFGRDRMDFDVTLPGESAVERQFQVSLKWAGEISLTSLEDAMEGRINQVPYETVKAVDVILRHLPSLKYSPVGRSFFSPPAGYETGQSYPESKLGGGREVWFGFHQSIRPSQWKMMLNIDVSATAFYRAMPVIEFLAEVLELPIQALAERRVLSDSQRVKFTKEIRGLKIEINHCGTMRRKYRVCNVTRRPAQTQTFPLTLENGSSIEKTVLKYFQDKYGLTLKYPHLPCLQVGQEAKHTYLPIEVCCVVSGQRCIKKLTDSQTSTMIKATARTAPERERDIANLVRKAEFSADPFAHEFGITINPAMTEVKGRVLMAPKLLYGGRQNSTAVPNQGVWDLRGKQFHTGIEVRVWAIVCFADQNHVKENDLRAFTQHLQRISHDAGMPIIGNPCFCKYAVGVEQVEPMFKYLKQNYPELQLVVIVLPGKTPVYDKKCERTCGNTDRILVLKSKQRVWISGHTYIYTLKSNVLETPSSESPLNVSRPKNVTRTTPQTLSNICMKMNMKLGGVNCVLYPNVRPKIFSESVIFLGCDITHPPAGDSRKPSVAAVVGSMDAHTVEVRGDCESSAKSTGNYPRRCRRMVSPEGQFFNVLQYELRAIREACMMLETGYQPGITFIAVQKRHHTRLFSVDKNDRVGKAFNIPPGTIVDVGITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNDMSADQLQQLTYQMCHTYARCTRSVSIPAPAYYAHLVAMRARFHLVDRDHESGEGSQPSGTSDDSTFSSMARAVQVHPKANKVMYFA"

     misc_feature    73..2559
                     /locus_tag="CRE_09584"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    157..573
                     /locus_tag="CRE_09584"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    604..774
                     /locus_tag="CRE_09584"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    775..1140
                     /locus_tag="CRE_09584"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(934..936,979..981,1021..1023,1033..1035,1087..1089,
                     1108..1110,1114..1116)
                     /locus_tag="CRE_09584"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1273..2580
                     /locus_tag="CRE_09584"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1684..1686,1786..1788,1834..1842,1849..1851,
                     1873..1875,1882..1884,1894..1896,1906..1908)
                     /locus_tag="CRE_09584"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1987..1989,1993..1995,2131..2133,2548..2550)
                     /locus_tag="CRE_09584"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

atggagactgagatagagctcgcctccgacccgaccatccaattgctctccgccatgacatcaatgcgtgtggacagtggtggagcaccaggaccaccaccagcttctgccacttcttccctcgctcgctcgggagtccaattcagttgcccacgtcgtccgaatcatggagtcgaaggacgtgccatcctccttcgtgccaaccacttctccgtccggattccaggcggtaccatccagcactacaatgtcgatgtgatgcctgataagtgtccgcgacgtgtcaatcgcgaaatcatcggatgcctcatctcatccttcactcgctacttcaccaacgtccgccctgtgtacgatgggaagaacagtatgtacacccgcgatcttctaccattcggaagagatcgtatggatttcgacgtgacgctcccaggagaatcagcggtggaacgtcaattccaagtctccctaaaatgggctggagagatctcgttgacaagtttggaagacgcgatggagggacgtatcaaccaggttccatacgagactgtcaaagcggttgatgtgattttgagacacttgccgtcactcaagtactcaccggttggaagatccttcttctcgccaccagctggatatgaaactggacaaagttatccggagagcaagctcggcggaggacgtgaagtatggtttggattccatcaatcgattcgtccatctcaatggaaaatgatgttgaatatcgatgtctctgccaccgcattctatcgtgccatgccagtcattgaattcctcgccgaagtcctggagcttccgattcaagctcttgccgagcgtcgtgtgctctctgactctcaacgagtcaagtttacaaaagagatccggggtctcaagattgagataaatcactgtggaacgatgcgacgaaagtatcgagtgtgcaatgtgacgagacgtccagctcagacgcagacgttcccgttgacactggagaatgggtcgtcgattgagaagactgtgttgaagtacttccaggataagtatggattgacattgaagtatccacacttgccatgtcttcaggttggtcaagaggcaaagcacacgtatctccccatcgaagtctgctgcgttgtctccggtcaacgttgcatcaagaagctcaccgactcccagacgtccacaatgatcaaggcgaccgcccgtaccgctccagaacgtgagcgtgacattgcgaatctcgtccgtaaagccgagttctctgccgacccattcgctcatgaatttggaataaccatcaatccagcgatgactgaagtcaaggggcgtgtcctcatggcaccgaaactcttgtacggaggtcgacagaactcgacagccgtgccgaatcaaggagtttgggatctgagaggaaaacagttccacactggaatagaagttcgcgtatgggcgatcgtctgcttcgccgatcagaatcatgtgaaggagaacgatttgagagcattcactcaacacctccaacgtatttctcatgacgctggaatgccaattatcgggaacccgtgcttctgcaaatatgctgtcggcgtggaacaagtcgagccgatgttcaagtatttgaagcagaactatccagagcttcagttggtcgtcattgttcttccaggaaagacgcctgtttatgacaaaaaatgcgaacggacatgtggaaatacagacagaattctagttttaaagagcaagcagagagtctggatatctggacacacatacatttacacactgaaatcaaacgtgttggagacaccgtcctcggaatcgccactcaatgtatccaggcccaaaaacgtgacccgcacaacgccacagacgctctcgaacatttgcatgaagatgaacatgaaactgggcggagtcaactgtgtcctctaccccaacgtccgcccgaagatattcagcgagtcggtcatcttcctcggctgtgacatcactcatccaccagccggtgactcacgaaaaccatcggtcgccgcagtggtcggatccatggatgctcataccgtcgaagtacgcggcgactgtgagagttcagccaaatcgacaggaaattatcctcggagatgtcggcgaatggtgtctccggagggacagtttttcaacgtcctacagtatgagcttcgtgcgattcgagaggcctgcatgatgctggaaaccggatatcaacctggaatcaccttcatcgctgtgcagaagagacatcacacccggttgttctctgtggataagaatgatcgagtgggaaaggcgttcaatattccgcctggaacaattgtcgatgttggaatcacccacccgaccgaattcgacttctacctttgttcacacgctggaatccaaggaacatcccgcccgtctcactatcatgtgctttgggatgataacgatatgtcggcagatcagttgcaacagttgacttatcaaatgtgccatacctatgctcggtgcacacggtcggtgtcgataccggcgccagcgtactacgcgcacttggtggcgatgcgcgcgagattccacttggtggatagggaccacgagtcgggagaggggtcgcaaccatcgggaacttcggatgactcgacattctcgagcatggctagagctgttcaggtccacccgaaggcaaacaaagtgatgtactttgcttag

//