GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:31:47, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_003089063            2351 bp    mRNA    linear   INV 13-OCT-2010
DEFINITION  Caenorhabditis remanei hypothetical protein (CRE_18336) mRNA,
            partial cds.
ACCESSION   XM_003089063
VERSION     XM_003089063.1
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis remanei
  ORGANISM  Caenorhabditis remanei
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis.
REFERENCE   1  (bases 1 to 2351)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     PCAP assembly of the Caenorhabditis remanei genome
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 2351)
  AUTHORS   Wilson,R.K.
  CONSRTM   The Caenorhabditis remanei Sequencing Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (17-JUL-2007) Genome Sequencing Center, Washington
            University School of Medicine, 4444 Forest Park Parkway, St. Louis,
            MO 63108, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003318458).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2351
                     /organism="Caenorhabditis remanei"
                     /mol_type="mRNA"
                     /strain="PB4641"
                     /db_xref="taxon:31234"
     gene            <1..>2351
                     /locus_tag="CRE_18336"
                     /db_xref="GeneID:9814228"
                     /db_xref="WormBase:WBGene00074441"
     CDS             1..>2351
                     /locus_tag="CRE_18336"
                     /note="contains similarity to Vanderwaltozyma polyspora
                     Putative uncharacterized protein.; TR:A7TJN8"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_003089111.1"
                     /db_xref="WormBase:CRE18336"
                     /db_xref="GeneID:9814228"
                     /db_xref="WormBase:WBGene00074441"
                     /translation="
MSSWFSYFGFSKGPPLEEVTEESEEEETQVPEHVVPKTAEEELAEAMNRLSPEQQSLIQDVLRRAENSRKEAKVVVDAEMMRSRYRQRESIEGSQEIDHRYSLVQMDSIPENMVTNEMEERAASQREFMHESSQKSPISPNVTRKLHEKRPSITEATTESLRNRFQKMKSHLTTWFNSLDYDGEYTFDFTSKHDKSEKLSDLTMQYIDALSQAIMISSHIEYSHYLLSSNPDFHLMCTNFCESIFNLAFNDLADQTVDENVRDKLNDFCGRIAEEALQSAFFMMVSKTLSSSKECENIINEISLLHKSRSFESAQQLDQFLSKIENEDEDRESSRKSSPYMYEVLGTSSESPSSSSSYEFKSQNSYESEVSNETPNVHVEELFDLQPYDTYKTDDDEEVFRSENILFECSQTSTPDNSLKEKTEEATSFMTPGEEHYIWISGPLGRINEEHEHDDEDDEVQTESSSDSMIMHENSSEPIMQLNVEEYIQTMIEKLSSHHSIHEAPRFSCKKLWSTFAYDRSSPLLEPVEEPIFEKKEPELTQEEIDHIVWIQSLAEQSSFEQAAPPTRPPVPQRMATVEEPIATTDLHEEDRSSATSGADIEQSLDQEVAYDRSSPLLEPVEEPIFEKKEPELTQEEIDHIVWIQSLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATSGADIEQSFDQEVAYDRSSPLLEPVEEPIFEKKEPELTQEEIDHIVWIQSLAEQSSFEQAAPPTRPPVPQRMATVEEPVVTTDLHEEDRSSATS"
ORIGIN      
atgtcttcgtggttttcttactttggattcagtaaaggacctcctctcgaagaggtgacggaggaatccgaggaagaagaaactcaagtgcccgaacatgttgtgcctaaaaccgccgaagaagaattggcggaagcaatgaatcggttgtctccagagcaacaaagtctgattcaagatgtgctgagacgagcagaaaactcgagaaaagaagcaaaagtagttgtcgatgcagaaatgatgagatcaagatacagacaaagagaatcaatcgaaggatcacaagagattgatcatcgatattcattggttcaaatggattcaatacctgaaaatatggtaacaaatgaaatggaagaaagagcagcttctcagagagaattcatgcatgaatcaagtcagaaaagtccaataagtccgaatgtaacaagaaaattacatgaaaaacgaccatcaattactgaagccacaactgaaagtctacgaaatagattccaaaagatgaaatctcatctaacaacttggttcaattcacttgattatgacggagaatacacatttgattttacgagtaaacacgataaatcggagaaactcagtgaccttactatgcaatatattgatgctttgagtcaggcaataatgatatcatctcatattgaatattcacattacttgctatcctcgaatcccgatttccacttgatgtgtactaatttctgtgaatcgatattcaatttggcattcaatgatttggctgatcaaaccgtagatgaaaacgtgagagacaagttgaatgatttctgtggtcgaattgcggaagaagctcttcaatctgctttcttcatgatggtatcaaagacgttatcgtcttccaaagaatgcgaaaatatcatcaatgaaatatctctgttgcacaaatcaaggtctttcgaaagtgctcagcaactagatcagtttttgagtaaaatagagaacgaagatgaagatcgggaatctagtagaaaatcatcaccatatatgtacgaagtgcttggaacgtcatctgaaagtccatcatcatcttcatcatatgagtttaaatcacaaaattcttacgagtcagaagtatcaaacgaaaccccgaatgttcacgttgaagaattgtttgatctccaaccgtacgatacatacaaaaccgatgatgacgaggaagtgttccggtctgagaacatactttttgaatgctcgcagacatcaactccagacaacagtctaaaagaaaaaacagaagaggctacttcgttcatgactccaggcgaagaacactatatttggatttctgggccacttggaaggataaacgaagaacatgaacatgacgatgaagatgacgaagttcagaccgagagtagctcagacagcatgataatgcatgagaactcttccgagccaataatgcaattgaatgtcgaagaatacatccaaacaatgattgaaaaactgagcagtcatcattcgatacatgaagcaccaagattctcgtgcaagaaactatggtccaccttcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcgaaaagaaagaaccggaactgactcaagaagagattgatcacatcgtttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccaattgctacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacatcgaacaatccttggatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcgaaaagaaagaaccggaactgactcaagaagagattgatcacatcgtttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgaccgatcttcatgaagaggacagatccagtgcaacatcaggagctgacatcgaacaatccttcgatcaagaagtcgcttatgatcgatcttcacctttgttggaacctgtcgaagagccgattttcgaaaagaaagaaccggaactgactcaagaagagattgatcacatcgtttggattcaaagtctagctgagcagtcatcattcgaacaagcagcacctccgactcgtccaccagttcctcaaagaatggcaacagttgaagaaccagttgttacgacagatcttcatgaagaggacagatccagtgcaacatcaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]