GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:45:55, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_003073592             423 bp    mRNA    linear   PLN 10-OCT-2017
DEFINITION  Encephalitozoon intestinalis ATCC 50506 calmodulin (Eint_091500),
            partial mRNA.
ACCESSION   XM_003073592
VERSION     XM_003073592.1
DBLINK      BioProject: PRJNA51607
            BioSample: SAMN03081424
KEYWORDS    RefSeq.
SOURCE      Encephalitozoon intestinalis ATCC 50506
  ORGANISM  Encephalitozoon intestinalis ATCC 50506
            Eukaryota; Fungi; Microsporidia; Unikaryonidae; Encephalitozoon.
REFERENCE   1  (bases 1 to 423)
  AUTHORS   Pombert,J.F., Selman,M., Burki,F., Bardell,F.T., Farinelli,L.,
            Solter,L.F., Whitman,D.W., Weiss,L.M., Corradi,N. and Keeling,P.J.
  TITLE     Gain and loss of multiple functionally related, horizontally
            transferred genes in the reduced genomes of two microsporidian
            parasites
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (31), 12638-12643 (2012)
   PUBMED   22802648
REFERENCE   2  (bases 1 to 423)
  AUTHORS   Corradi,N., Pombert,J.F., Farinelli,L., Didier,E.S. and
            Keeling,P.J.
  TITLE     The complete sequence of the smallest known nuclear genome from the
            microsporidian Encephalitozoon intestinalis
  JOURNAL   Nat Commun 1, 77 (2010)
   PUBMED   20865802
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 423)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (10-OCT-2017) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   4  (bases 1 to 423)
  AUTHORS   Corradi,N., Pombert,J.-F. and Keeling,P.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (06-MAR-2014) Botany, University of British Columbia,
            3529-6270 University Boulevard, Vancouver, British Columbia V6T
            1Z4, Canada
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 423)
  AUTHORS   Corradi,N., Pombert,J.-F., Farinelli,L., Didier,E. and Keeling,P.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (22-JAN-2010) Botany, University of British Columbia,
            3529-6270 University Boulevard, Vancouver, British Columbia V6T
            1Z4, Canada
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_014423).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..423
                     /organism="Encephalitozoon intestinalis ATCC 50506"
                     /mol_type="mRNA"
                     /strain="ATCC 50506"
                     /db_xref="taxon:876142"
                     /chromosome="IX"
     gene            <1..>423
                     /locus_tag="Eint_091500"
                     /db_xref="GeneID:9698470"
     CDS             1..423
                     /locus_tag="Eint_091500"
                     /note="similar to ECU09_1220"
                     /codon_start=1
                     /product="calmodulin"
                     /protein_id="XP_003073638.1"
                     /db_xref="GeneID:9698470"
                     /translation="
MEETKRLQKVYQLFAESPTERVPTDRLGDILRFAGYIISESYAEELMASVPGEMFDFSQLVEICEKIREREITREELQKSFRRLDAENTSHIDAGRLVQILSSGENKFSQEEIEELLNILNPDGDGKICYDLIIKNIFGY"
     misc_feature    4..405
                     /locus_tag="Eint_091500"
                     /note="calmodulin; Provisional; Region: PTZ00184"
                     /db_xref="CDD:185504"
     misc_feature    226..393
                     /locus_tag="Eint_091500"
                     /note="EF-hand, calcium binding motif; A diverse
                     superfamily of calcium sensors and calcium signal
                     modulators; most examples in this alignment model have 2
                     active canonical EF hands. Ca2+ binding induces a
                     conformational change in the EF-hand motif, leading to...;
                     Region: EFh; cd00051"
                     /db_xref="CDD:238008"
     misc_feature    order(253..255,259..261,265..267,286..288,361..363,
                     367..369,373..375)
                     /locus_tag="Eint_091500"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238008"
ORIGIN      
atggaggagacaaaacgccttcaaaaggtttaccaactatttgcagagtcgcccactgagagagttcccaccgacaggttgggagatatcttgaggtttgcaggatacatcatatctgaaagttatgcagaagagctcatggcctcagttcctggagagatgtttgacttcagccagcttgtagagatctgcgagaaaatccgggaaagagagataacacgcgaggaactgcaaaagtcctttcgaagactggatgcagaaaatacctcgcacatcgatgcaggaaggcttgtccagattctttcttctggagaaaataagtttagtcaagaagagattgaagagcttttgaacattttgaatcccgatggagacgggaagatttgctatgacttgatcatcaagaacatatttggatactaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]