ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-18 10:21:22, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_003073592 423 bp mRNA linear PLN 18-APR-2022
DEFINITION Encephalitozoon intestinalis ATCC 50506 calmodulin (Eint_091500),
partial mRNA.
ACCESSION XM_003073592
VERSION XM_003073592.1
DBLINK BioProject: PRJNA51607
BioSample: SAMN03081424
KEYWORDS RefSeq.
SOURCE Encephalitozoon intestinalis ATCC 50506
ORGANISM Encephalitozoon intestinalis ATCC 50506
Eukaryota; Fungi; Fungi incertae sedis; Microsporidia;
Unikaryonidae; Encephalitozoon.
REFERENCE 1 (bases 1 to 423)
AUTHORS Pombert,J.F., Selman,M., Burki,F., Bardell,F.T., Farinelli,L.,
Solter,L.F., Whitman,D.W., Weiss,L.M., Corradi,N. and Keeling,P.J.
TITLE Gain and loss of multiple functionally related, horizontally
transferred genes in the reduced genomes of two microsporidian
parasites
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (31), 12638-12643 (2012)
PUBMED 22802648
REFERENCE 2 (bases 1 to 423)
AUTHORS Corradi,N., Pombert,J.F., Farinelli,L., Didier,E.S. and
Keeling,P.J.
TITLE The complete sequence of the smallest known nuclear genome from the
microsporidian Encephalitozoon intestinalis
JOURNAL Nat Commun 1, 77 (2010)
PUBMED 20865802
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 423)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (15-APR-2022) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 4 (bases 1 to 423)
AUTHORS Corradi,N., Pombert,J.-F. and Keeling,P.J.
TITLE Direct Submission
JOURNAL Submitted (06-MAR-2014) Botany, University of British Columbia,
3529-6270 University Boulevard, Vancouver, British Columbia V6T
1Z4, Canada
REMARK Protein update by submitter
REFERENCE 5 (bases 1 to 423)
AUTHORS Corradi,N., Pombert,J.-F., Farinelli,L., Didier,E. and Keeling,P.J.
TITLE Direct Submission
JOURNAL Submitted (22-JAN-2010) Botany, University of British Columbia,
3529-6270 University Boulevard, Vancouver, British Columbia V6T
1Z4, Canada
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. This record is derived from an annotated genomic
sequence (NC_014423).
COMPLETENESS: incomplete on both ends.
FEATURES Location/Qualifiers
source 1..423
/organism="Encephalitozoon intestinalis ATCC 50506"
/mol_type="mRNA"
/strain="ATCC 50506"
/db_xref="taxon:876142"
/chromosome="IX"
gene <1..>423
/locus_tag="Eint_091500"
/db_xref="GeneID:9698470"
CDS 1..423
/locus_tag="Eint_091500"
/note="similar to ECU09_1220"
/codon_start=1
/product="calmodulin"
/protein_id="XP_003073638.1"
/db_xref="GeneID:9698470"
/translation="
MEETKRLQKVYQLFAESPTERVPTDRLGDILRFAGYIISESYAEELMASVPGEMFDFSQLVEICEKIREREITREELQKSFRRLDAENTSHIDAGRLVQILSSGENKFSQEEIEELLNILNPDGDGKICYDLIIKNIFGY"
misc_feature 4..405
/locus_tag="Eint_091500"
/note="calmodulin; Provisional; Region: PTZ00184"
/db_xref="CDD:185504"
ORIGIN
atggaggagacaaaacgccttcaaaaggtttaccaactatttgcagagtcgcccactgagagagttcccaccgacaggttgggagatatcttgaggtttgcaggatacatcatatctgaaagttatgcagaagagctcatggcctcagttcctggagagatgtttgacttcagccagcttgtagagatctgcgagaaaatccgggaaagagagataacacgcgaggaactgcaaaagtcctttcgaagactggatgcagaaaatacctcgcacatcgatgcaggaaggcttgtccagattctttcttctggagaaaataagtttagtcaagaagagattgaagagcttttgaacattttgaatcccgatggagacgggaagatttgctatgacttgatcatcaagaacatatttggatactaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]