2024-05-20 10:06:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_002948870 351 bp mRNA linear PLN 13-AUG-2010 DEFINITION Volvox carteri f. nagariensis hypothetical protein, mRNA. ACCESSION XM_002948870 VERSION XM_002948870.1 KEYWORDS RefSeq. SOURCE Volvox carteri f. nagariensis ORGANISM Volvox carteri f. nagariensis Eukaryota; Viridiplantae; Chlorophyta; core chlorophytes; Chlorophyceae; CS clade; Chlamydomonadales; Volvocaceae; Volvox. REFERENCE 1 (bases 1 to 351) AUTHORS Prochnik,S.E., Umen,J., Nedelcu,A.M., Hallmann,A., Miller,S.M., Nishii,I., Ferris,P., Kuo,A., Mitros,T., Fritz-Laylin,L.K., Hellsten,U., Chapman,J., Simakov,O., Rensing,S.A., Terry,A., Pangilinan,J., Kapitonov,V., Jurka,J., Salamov,A., Shapiro,H., Schmutz,J., Grimwood,J., Lindquist,E., Lucas,S., Grigoriev,I.V., Schmitt,R., Kirk,D. and Rokhsar,D.S. TITLE Genomic analysis of organismal complexity in the multicellular green alga Volvox carteri JOURNAL Science 329 (5988), 223-226 (2010) PUBMED 20616280 REFERENCE 2 (bases 1 to 351) AUTHORS Kuo,A., Prochnik,S.E., Terry,A., Salamov,A., Pangilinan,J., Shapiro,H., Schmutz,J., Grimwood,J., Lindquist,E., Pitluck,S., Lucas,S., Umen,J., Nedelcu,A., Hallmann,A., Miller,S., Nishii,I., Ferris,P., Mitros,T., Fritz-Laylin,L.K., Hellsten,U., Chapman,J., Simakov,O., Rensing,S.A., Kapitonov,V., Jurka,J., Schmitt,R., Kirk,D., Rokhsar,D.S. and Grigoriev,I.V. CONSRTM US DOE Joint Genome Institute (JGI-PGF) TITLE Direct Submission JOURNAL Submitted (02-JUL-2010) US DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_003307555). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..351 /organism="Volvox carteri f. nagariensis" /mol_type="mRNA" /strain="Eve" /db_xref="taxon:3068" /chromosome="Unknown" /forma="nagariensis" gene <1..>351 /locus_tag="VOLCADRAFT_58884" /db_xref="GeneID:9623621" CDS <1..351 /locus_tag="VOLCADRAFT_58884" /note="predicted protein" /codon_start=1 /product="hypothetical protein" /protein_id="XP_002948916.1" /db_xref="JGIDB:Volca1_58884" /db_xref="GeneID:9623621" /translation="
CCCACCCACCCACCCACCCACCCACCGTCCRCSCLPVSPSSCCCPVICPCHLACGCPCHLACGCPCHLAFCPCHLACGCPCHLACGCPCHLACGCPCHLACGCPYHLACGCPCHLA"
ORIGIN
tgctgctgcgcctgctgctgcgcctgctgctgcgcctgctgctgcgcctgctgctgcgcctgctgctgcgcctgctgcggtacctgttgtcgttgcagctgccttcctgtttccccctcttcctgctgttgtccggttatctgcccgtgccacctggcttgtggctgcccgtgccatctggcttgtggctgcccgtgtcatctggctttctgcccgtgccacctggcttgtggctgcccgtgccatctggcttgtggctgcccgtgccatctggcttgtggctgcccgtgccatctggcttgtggctgcccatatcatctggcttgtggctgcccatgccatctggcttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]