GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 05:42:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_002908062            2580 bp    mRNA    linear   PLN 22-JUL-2010
DEFINITION  Phytophthora infestans T30-4 Argonaute4 (AGO4) (PITG_01443) mRNA,
            complete cds.
ACCESSION   XM_002908062
VERSION     XM_002908062.1
KEYWORDS    RefSeq.
SOURCE      Phytophthora infestans T30-4
  ORGANISM  Phytophthora infestans T30-4
            Eukaryota; Sar; Stramenopiles; Oomycota; Peronosporales;
            Peronosporaceae; Phytophthora.
REFERENCE   1  (bases 1 to 2580)
  AUTHORS   Nusbaum,C., Haas,B., Kamoun,S., Fry,W., Judelson,H., Ristaino,J.,
            Govers,F., Whisson,S., Birch,P., Birren,B., Lander,E., Galagan,J.,
            Zody,M., Devon,K., O'Neil,K., Zembek,L., Anderson,S., Jaffe,D.,
            Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Mauceli,E.,
            Brockman,W., Young,S., LaButti,K., Sykes,S., DeCaprio,D.,
            Crawford,M., Koehrsen,M., Engels,R., Montgomery,P., Pearson,M.,
            Howarth,C., Larson,L., White,J., O'Leary,S., Kodira,C., Zeng,Q.,
            Yandava,C. and Alvarado,L.
  CONSRTM   The Broad Institute Genome Sequencing Platform
  TITLE     Annotation of Phytophthora infestans T30-4
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 2580)
  AUTHORS   Nusbaum,C., Kamoun,S., Fry,W., Judelson,H., Ristaino,J., Govers,F.,
            Whisson,S., Birch,P., Birren,B., Lander,E., Galagan,J., Zody,M.,
            Devon,K., O'Neil,K., Zembek,L., Anderson,S., Jaffe,D., Butler,J.,
            Alvarez,P., Gnerre,S., Grabherr,M., Mauceli,E., Brockman,W.,
            Young,S., LaButti,K., Sykes,S., DeCaprio,D., Crawford,M.,
            Koehrsen,M., Engels,R., Montgomery,P., Pearson,M., Howarth,C.,
            Larson,L., White,J., O'Leary,S., Kodira,C., Zeng,Q., Yandava,C. and
            Alvarado,L.
  CONSRTM   The Broad Institute Genome Sequencing Platform
  TITLE     Direct Submission
  JOURNAL   Submitted (23-OCT-2006) Broad Institute of MIT and Harvard, 7
            Cambridge Center, Cambridge, MA 02142, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003303757).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2580
                     /organism="Phytophthora infestans T30-4"
                     /mol_type="mRNA"
                     /strain="T30-4"
                     /db_xref="taxon:403677"
     gene            <1..>2580
                     /locus_tag="PITG_01443"
                     /db_xref="GeneID:9468805"
     CDS             1..2580
                     /locus_tag="PITG_01443"
                     /codon_start=1
                     /product="Argonaute4 (AGO4)"
                     /protein_id="XP_002908108.1"
                     /db_xref="GeneID:9468805"
                     /translation="
MDPRKQELWSGRAPPLKINPEDPELQMETRVCRRPGFGKDGRTMKMNVNYFSISLDKAPVEVFKYHVDPARLLPRALVRNVINAALTQYKAELGGVRVVHDGMSALFAPQKFEWNARDFPDVNPDRPSSEQQKDGGFRRRGPPTFIVKVKLAETIALQSVEEHYRNPDENVMPVLQALDIVARHLGAQRLVSVGRNFFAMKKTHELKGGKELCWGYHQAIRVAEKKLLLNIDQAASVFYQPCELMKLATSALNVRSPADAHGLSERDMRSLARALRKVEVYPTHRKDRKRAIFGVSPDRADRTLVDIKGETMSVADYFYKKYNMRLRYPNLPLVNVGSRKAGREKWLPIELCEVAPGQRCPNINDLDTAEIIRQTSQPPHQRRETILGQIRQAGFENDPYLAAFGLEVDQQLETAEARVLDPPDVQYANVSERPSGGQWNLRDKKFVHGAVLRNWGVVVDANVSPRDVNNFIGILVDTASKCGLSVECRSPPVIDRSSCKRVEVEDLMKFCFQELETRGNGAPQLILVIKQDKGSVSYGRIKRMSDTVLGIPSQCIVATNLRKANPQVCANVCLKMNMKLSGKNSVLREPLPLISTCPTIVIGADVEHPRSGMGSRPSIASVVASMDAYSAKYIGRVAAQKAANDIQQLPHMLRDLFLAFYQSTNRQPERVIYYRDGVSEGRFYDILQTEMRALRKTFKMLSDDYNPPVTFVVVNKRHHMRAFRINPRDADRKGNVVPGTVLDTDVVSPHRFDFFLYGHSAIQGTSVPCHYTVLHDENRMTADELQRLTYHLGYTFVRCTRSVSFATPAYYAHLAAGRARFFLYEGSSDTASMSTNLSSSSNFDFAGVHKNMLDCMFYV"
     misc_feature    295..543
                     /locus_tag="PITG_01443"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    574..720
                     /locus_tag="PITG_01443"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    760..1065
                     /locus_tag="PITG_01443"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    1195..2469
                     /locus_tag="PITG_01443"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1612..1614,1624..1626,1660..1671,1678..1680,
                     1702..1704,1711..1713,1723..1725,1735..1737)
                     /locus_tag="PITG_01443"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1813..1815,1819..1821,2026..2028,2437..2439)
                     /locus_tag="PITG_01443"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atggacccacgcaaacaagagctatggagcggccgtgctcctcctctgaagatcaacccggaagaccctgagctgcagatggagacgcgggtctgccgacgcccaggtttcggcaaagacggcagaacgatgaagatgaatgtgaactacttcagtatctcgttggacaaagctcccgttgaggtgttcaagtatcacgtcgaccctgcacgacttctgcctcgagctttggtacgtaacgtgatcaacgctgccctgactcagtacaaagccgagttgggaggcgttcgagtcgttcacgacggtatgtcggcactgttcgcaccgcaaaagttcgagtggaacgcccgagacttcccagacgtgaacccggacagaccgagttcggagcagcagaaagatggaggctttcgtcggcgaggtccgccaacattcattgtcaaggtgaagctagcggagactatcgctcttcagagtgttgaggagcactaccgaaacccagacgagaatgtgatgcccgttcttcaggcactcgacattgttgcacgtcaccttggagcccagcgcctcgtttcagttggacgcaatttcttcgctatgaaaaagacgcacgaattgaaaggaggcaaagagctgtgctggggataccaccaagccattcgcgtggcggagaagaagctgctgctgaacattgaccaggctgccagtgtgttctaccagccctgtgagctcatgaagctggcgacttcggctcttaatgttcgctctcctgcagatgcacacggtctctcagagcgagatatgcggagcttggcgcgagctctacgcaaagtagaagtgtacccgacacaccgcaaagaccgcaagcgcgccatctttggtgtcagtcctgatcgtgccgaccggactttggtggatatcaagggcgagacgatgagcgtggctgattacttttacaagaagtacaacatgcgacttcgatacccgaatctgccgcttgtgaacgtgggcagtaggaaagctggcagagagaagtggctgccgatcgagctgtgcgaagtcgcaccggggcagcgctgtccgaatatcaacgacctcgatacggccgagatcattcgccagaccagtcagccgcctcatcagcgtcgagagaccatactgggtcagatccgtcaagcaggatttgagaacgatccgtacttggctgctttcgggctggaggtcgaccagcaactcgagacggcggaggcgcgtgtgctcgatcctcccgacgtgcagtacgcgaatgtttctgagcgcccgtcgggtggccagtggaatttgagagacaagaagtttgtccacggcgcggtacttcgcaactggggagtggtggtggacgctaatgtgagtcctcgcgatgtgaataatttcattgggatactggtggacactgcgagtaagtgcggactttcggtggagtgtcgaagtccaccggtgattgatcgctcttcctgtaaacgggtagaagtggaggatctgatgaagttctgcttccaagagctggaaacccgtggcaacggcgctcctcagctcattttggtgattaagcaagacaagggatccgtctcgtacggccggatcaagcgcatgtcagacacggtgctggggatcccaagccaatgcatcgtcgcgacaaacctgcgcaaagccaacccgcaggtgtgtgcgaatgtgtgcttgaagatgaacatgaagttgagtggcaagaactctgtgcttcgagagcctctaccgctcatcagtacatgccctacaatcgtgatcggggctgacgtcgagcacccacgctctggaatgggctctcgaccttccattgcgtctgttgtggcgtcgatggacgcgtactcggccaagtacattgggcgtgtggcagctcaaaaagcagcaaacgacatacagcaattgccgcatatgctgcgtgatctcttcttggcgttctaccagagcaccaaccgccaacccgagcgcgtcatctattaccgcgatggcgttagcgaaggccgcttctacgatattctacaaaccgaaatgcgagctctacgcaagacgttcaagatgctatcggacgactacaacccgcccgtgaccttcgtggtggtcaacaagcgccaccacatgcgagctttccgaataaatcctcgagacgccgaccgcaagggtaatgtggtgccgggcaccgtgctcgacacggacgtcgtgagtccacaccgattcgacttcttcttgtatggccacagtgccatccaaggcacgagtgttccgtgtcactacacggtgctgcatgatgagaacaggatgactgccgacgagctgcagagactcacgtaccacctcggatacacgtttgtgcggtgtacccgctcggtgtcgttcgcgactccagcgtactatgcgcaccttgctgctggacgtgctcggttcttcttgtacgaaggatcgtcggacactgcgtcgatgagcaccaacttgtcgagctcgtccaacttcgacttcgcaggcgtgcacaagaacatgctggactgcatgttctacgtgtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]