LOCUS       XM_002778064             160 bp    mRNA    linear   INV 30-APR-2010
DEFINITION  Perkinsus marinus ATCC 50983 hypothetical protein, mRNA.
ACCESSION   XM_002778064
VERSION     XM_002778064.1
KEYWORDS    RefSeq.
SOURCE      Perkinsus marinus ATCC 50983
  ORGANISM  Perkinsus marinus ATCC 50983
            Eukaryota; Sar; Alveolata; Perkinsozoa; Perkinsea; Perkinsida;
            Perkinsidae; Perkinsus.
REFERENCE   1  (bases 1 to 160)
  AUTHORS   El-Sayed,N., Caler,E., Inman,J., Amedeo,P., Hass,B. and Wortman,J.
  TITLE     Direct Submission
  JOURNAL   Submitted (09-JUL-2008) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003209596).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..160
                     /organism="Perkinsus marinus ATCC 50983"
                     /mol_type="mRNA"
                     /strain="ATCC 50983"
                     /culture_collection="ATCC:50983"
                     /db_xref="taxon:423536"
                     /note="strain co-identity: ATCC 50983 = PmCV4CB5 2B3 D4"
     gene            <1..>160
                     /locus_tag="Pmar_PMAR018549"
                     /db_xref="GeneID:9038014"
                     /db_xref="VectorBase:PMAR018549"
     CDS             <1..>160
                     /locus_tag="Pmar_PMAR018549"
                     /note="encoded by transcript Pmar_PMAR018549-RA"
                     /codon_start=2
                     /product="hypothetical protein"
                     /protein_id="XP_002778110.1"
                     /db_xref="VectorBase:PMAR018549-PA"
                     /db_xref="GeneID:9038014"
                     /db_xref="VectorBase:PMAR018549"
                     /translation="

RTASGQSGSDHSVHSDREAAHRPRLQDRGPDPAVRDLEPRRGPRARPYLPEYE"

ORIGIN      

acgtacagcttctgggcagtcgggatcggaccactcagtccattccgaccgtgaagccgcccatcgacctcgccttcaagatcggggccctgatcctgccgtccgtgaccttgaaccgcgtcgtggcccccgtgctcgtccttacctacccgaatacgag

//