2024-05-15 21:50:16, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_002745545 3558 bp mRNA linear PRI 18-MAR-2023 DEFINITION PREDICTED: Callithrix jacchus nuclear factor kappa B subunit 1 (NFKB1), transcript variant X1, mRNA. ACCESSION XM_002745545 VERSION XM_002745545.5 DBLINK BioProject: PRJNA939228 KEYWORDS RefSeq. SOURCE Callithrix jacchus (white-tufted-ear marmoset) ORGANISM Callithrix jacchus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Cebidae; Callitrichinae; Callithrix; Callithrix. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_071444) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 18, 2023 this sequence version replaced XM_002745545.4. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_011100555.1-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3558 /organism="Callithrix jacchus" /mol_type="mRNA" /isolate="mCalJac1" /db_xref="taxon:9483" /chromosome="3" /sex="male" /tissue_type="muscle" /dev_stage="juvenile" /country="USA: New York" /lat_lon="40.762676 N 73.955541 W" /collection_date="2018-06-12" /collected_by="Stephanie Marcus and Margaret Fabiszak" gene 1..3558 /gene="NFKB1" /note="nuclear factor kappa B subunit 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 13 mRNAs, 261 ESTs, 3 long SRA reads, 5 Proteins" /db_xref="GeneID:100415321" CDS 148..3057 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X1" /protein_id="XP_002745591.1" /db_xref="GeneID:100415321" /translation="
MAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGSGGGGTGSTGPGYSFPHYGFPTYGGISFHPGTTKSNAGMKHGAMDSESKTDPEGCDKSDDRDTVNLCRKVTETTEQDQEPSKATDGNGEVTLTYATGTKEENAEVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDYPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVSGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 274..879 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(316..318,322..327,331..336,343..354,577..579, 583..588,877..879) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 898..1203 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(901..903,907..915,919..927,1045..1053,1090..1092, 1126..1128,1183..1185,1192..1194,1198..1200) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(907..912,916..918,955..957,961..963,967..969, 1066..1071,1078..1080,1084..1086) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(970..972,976..978,1069..1074) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature order(1774..1776,1780..1782,1792..1797,1804..1812, 1816..1821,1831..1833,1840..1842,1885..1887,1891..1893, 1897..1899,1909..1914,1921..1929,1933..1938,1948..1950, 1957..1959,1984..1986,1990..1992,1996..1998,2008..2013, 2020..2028,2032..2037,2047..2049,2056..2058) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1774..1887 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1777..>2346 /gene="NFKB1" /note="Transient Receptor Potential channel, Vanilloid subfamily (TRPV); Region: TRPV; cl40437" /db_xref="CDD:454755" misc_feature 1891..1986 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1906..2190 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 2200..2289 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2593..2820 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" polyA_site 3558 /gene="NFKB1" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
ctcgctcgccccgacccgcacccgggcccgctcgggctccggccggccgccgcctcttccttctccagctcttaggcccgcgccgcccgggagggagagcccacccgcgacaggaagccgaacgctgactcgccacccggtttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtctgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgctcacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcatgtataaggggctacaatcctgggctcttggtgcaccctgaccttgcgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttaaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagataaagaagaagtgcagaggaaacgacaaaagctcatgcccaatttttcggatagtttcggcggtggtagtggtgctggagctggaggtggaggcatgtttggtagtggcagtggaggagggggcactggaagtacaggtccagggtatagcttcccacactatggatttcctacttatggagggatttccttccatcctggaactactaaatctaatgctgggatgaaacatggagccatggacagtgaatctaaaacggaccctgaaggttgtgacaaaagtgatgatagagacactgtaaacctctgtagaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccactgatgggaatggtgaggtcactctaacgtatgcaacaggaaccaaagaagagaatgctgaggttcaggataacctctttctagagaaggctatgcagcttgcgaagaggcatgccaatgcccttttcgactatgcagtgacaggagatgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactggaagtcacgtctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggccggggccgacctgagccttctggaccgcttcggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgactaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtccggacgcacagcactgcacctagctgtggagcacgacaacatctcattggctggctgcctgctccttgagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcggcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtatctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctaccctggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacactgaagcaattgaagtgatccaggcggcctccagcccagtgaagaccacctcgcaggcccactcgctgcctctctcgcctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaagctcagctttaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccgtgtaaaccaaagccctgaaattccactgtatcgtccacaagaagaaagctgaagcgcatccaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagtggatgcatctggggatgaggctgcttactgagctttgccggccactgctggatcacagctgctttctgttgtcattgttatttcccctctgctacgttcctgttttcattaaaggtatcactgtccccacctggcattccttctgaccatccatagcatcgttttgcattcaaattaagtgttaagaaagggatattttaaaatgagaatcacttgatgtgcaattttaaaaaaggcgtattactttttctaatgtggttatttctctgattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]