GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:26:26, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_002620465            3555 bp    mRNA    linear   PLN 27-NOV-2019
DEFINITION  Blastomyces gilchristii SLH14081 RNA interference and silencing
            protein (BDBG_09197), partial mRNA.
ACCESSION   XM_002620465
VERSION     XM_002620465.2
DBLINK      BioProject: PRJNA41099
            BioSample: SAMN02953742
KEYWORDS    RefSeq.
SOURCE      Blastomyces gilchristii SLH14081
  ORGANISM  Blastomyces gilchristii SLH14081
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Onygenales; Ajellomycetaceae;
            Blastomyces.
REFERENCE   1  (bases 1 to 3555)
  AUTHORS   Champion,M., Cuomo,C., Ma,L.-J., Henn,M.R., Klein,B., Goldman,B.,
            Young,S., Kodira,C.D., Zeng,Q., Koehrsen,M., Alvarado,L.,
            Berlin,A.M., Heiman,D.I., Hepburn,T.A., Saif,S., Shea,T.D.,
            Shenoy,N., Sykes,S., Galagan,J., Nusbaum,C. and Birren,B.
  CONSRTM   The Broad Institute Genome Sequencing Platform, Broad Institute
            Microbial Sequencing Center.
  TITLE     The Genome Sequence of Blastomyces dermatitidis strain SLH14081
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 3555)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (27-NOV-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3555)
  AUTHORS   Champion,M., Cuomo,C., Ma,L.-J., Henn,M.R., Klein,B., Goldman,B.,
            Young,S., Kodira,C.D., Zeng,Q., Koehrsen,M., Alvarado,L.,
            Berlin,A.M., Heiman,D.I., Hepburn,T.A., Saif,S., Shea,T.D.,
            Shenoy,N., Sykes,S., Galagan,J., Nusbaum,C. and Birren,B.
  CONSRTM   The Broad Institute Genome Sequencing Platform, Broad Institute
            Microbial Sequencing Center.
  TITLE     Direct Submission
  JOURNAL   Submitted (06-FEB-2009) Broad Institute of MIT and Harvard, 7
            Cambridge Center, Cambridge, MA 02142, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003101647).
            On Nov 27, 2019 this sequence version replaced XM_002620465.1.
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..3555
                     /organism="Blastomyces gilchristii SLH14081"
                     /mol_type="mRNA"
                     /strain="SLH14081"
                     /db_xref="taxon:559298"
                     /chromosome="Unknown"
     gene            <1..3555
                     /locus_tag="BDBG_09197"
                     /db_xref="GeneID:8501149"
     CDS             1..2718
                     /locus_tag="BDBG_09197"
                     /note="At least one base has a quality score < 10"
                     /codon_start=1
                     /product="RNA interference and silencing protein"
                     /protein_id="XP_002620511.1"
                     /db_xref="GeneID:8501149"
                     /translation="
MSGKPQRKGRGSARVDRGGGGGGRGGRDGGGQRHPIFGQTPDTPRNRREGVASGDAAQASAISCAGFSDLEIFSYQSHVPQPNSTVQSVENHVNTAVLALSSTSKEPKLPQRPTFGTQGNKVTLYANYFELAVKQDLSLYRYKIILDPDEKGRLPIGRKAKQIIRLFLDQEFYKLSDKIASDFKSTIISSVELEPLQKLPYIVTYQAEDELEPAPNARMYTLKVTRTGTLQVSALVDYLSSTSANAVFGGKEEVIQALNVVMGYYPKDSEHIANVGTNKHFFINPPDVEKWDLTGGLEVLRGFFGSVRAATARILLNVQISNVAVFAEGPLPRVMMSFFQSYGHSMGKLDRFLKSVRVQLTHMKKVGSDGREVLPIKTILGVATIDDGRGMKNKPRVQRVGAGPKDVTFYKEPNADDEMLGANTSSTAGAYVSVFEFFRDIRKITLENPDLPVVNIGSRERPIYLPPDVCIVLPGQAPNMTLSTTQTQQMIKFAVRRPALNAKSINTKGAQILGASQPANSTLAGFGLAVQPGLITVPGRVLQGPQVRYKSVGRDARPPTNPNSGSWNLQRNQFSVAKPLKNWACLWIQKRDTSLPWPDAETLSSQALDPFIRQLKQLGMTVDQPLIHICPDDFERSIEEHIASVLQFKPSLQLIFFILPVVSSIYSRIKYLCDVKWGVHSICVVAGKFAKERNCHLLQNPAWRLWAKQPPATRLPRKTSLRVPRRRLQEGAVQTPSLNEGTCPLLQKGLPASPIPRRQAGHRKEASRAPSRIIIRRPRRQQHAAFFGLPRPPPPTASFNPRNGTVVDRAVTDARNWDFFLQAHTPLHGTARPGHYYPVYDEIFRSSVVKPSLARLTGGIGANVADAVEALTHNMCYLFGRATKSVSVCRRRIMRIWSVRGLGVI"
     misc_feature    307..2664
                     /locus_tag="BDBG_09197"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    334..786
                     /locus_tag="BDBG_09197"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    832..978
                     /locus_tag="BDBG_09197"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    982..1419
                     /locus_tag="BDBG_09197"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1117..1119,1225..1227,1300..1302,1312..1314,
                     1366..1368,1387..1389,1393..1395)
                     /locus_tag="BDBG_09197"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1564..2667
                     /locus_tag="BDBG_09197"
                     /note="Piwi-like: PIWI domain. Domain found in proteins
                     involved in RNA silencing. RNA silencing refers to a group
                     of related gene-silencing mechanisms mediated by short RNA
                     molecules, including siRNAs, miRNAs, and
                     heterochromatin-related guide RNAs. The...; Region:
                     Piwi-like; cl00628"
                     /db_xref="CDD:294420"
ORIGIN      
atgtcaggaaagccacagaggaaaggtcgaggatcagcgcgagttgaccgcggtggtggtggaggtggccgcgggggccgggatgggggtgggcaaagacatcctatatttggacagactcctgacacccctcgtaataggagagagggcgtcgcgagtggagacgccgcccaagcaagcgccataagttgtgctgggttctccgatctggaaatcttctcatatcaaagtcatgtcccccaaccaaatagtacggttcagagcgtcgaaaatcatgtcaacactgccgttctagccttgagttcgacatccaaggagcccaaactgccccagcgtccaaccttcggaactcaagggaataaagtcaccctatacgcaaactatttcgagttggccgtgaagcaggatctttctctctaccgctataaaatcattctagatccggatgaaaagggaagactccccatcggcagaaaagcgaaacagatcatccgcctgttcctggatcaggagttttataagctcagcgacaagatcgccagtgactttaagtccaccatcatcagcagcgtggaactcgaacctcttcaaaagttgccttatatagtcacgtaccaagccgaggatgagctagagcccgctccaaatgccagaatgtacactctcaaagttactcgcactggtactctgcaagttagtgcactggtggactacctttcttctaccagtgcaaatgctgtattcggcggcaaggaagaggtcatccaggcactgaacgtcgttatgggatactaccccaaagactcagaacatatcgccaatgtcggtacaaacaagcatttctttataaacccccctgacgttgaaaaatgggacttgaccggcggactagaggtgctacggggattctttggcagcgtccgtgcagccactgcacgcattcttctgaacgttcaaatcagcaacgttgcggtgtttgcagaaggtccattgcctcgggtgatgatgagtttcttccagagttacggacacagtatgggaaagctggacaggttcctaaaatcggtccgcgtgcagttaacgcatatgaaaaaagttggtagtgatgggcgcgaagtcctacccataaagactattctaggcgtggccactattgatgatggccgcggaatgaaaaacaaaccaagagtgcagagagttggtgccggaccgaaggatgtgacgttttacaaagagcccaatgctgatgatgaaatgttgggcgcaaatacttctagtacagctggcgcctacgtgagcgtgtttgaatttttcagggacattcgcaaaattactctggaaaatcccgatcttcccgtcgtcaatatcggaagccgggagcgtccgatatatttgccccctgacgtgtgcattgtattgcctgggcaggctcccaatatgactctaagcacgacccaaacccagcagatgatcaagtttgcggtccgccgccctgcgctaaatgcgaagtcgataaatacaaaaggagcacagatcttaggcgcttctcagcctgcgaactccactttggctggatttggacttgcagtgcagccgggattaattacagtgcctggacgagtcttgcagggcccacaggtcagatataaatcggtagggagggatgctcggccacccacgaatccgaattctggcagctggaatttgcaacgtaatcaattctcagttgcaaaacccctgaagaactgggcatgtctctggattcagaaacgcgatactagtctaccttggccagatgctgaaacgctttcgagccaggcattggatccattcattagacagttaaaacaattgggcatgactgttgaccaacccctgattcacatatgccctgacgactttgaacgatcgatcgaagagcatattgccagtgtgttacaatttaaaccttcgctccaacttattttcttcatcctccctgttgtcagcagcatctacagccgcatcaagtacctctgcgatgtcaaatggggcgtgcatagcatctgcgtcgtcgccggcaaattcgccaaagaaaggaactgccacctcctccaaaatcccgcctggcggctctgggccaaacaaccacccgccacccgcctaccccggaaaacatccctccgtgtaccgcgacggcgtcttcaagaaggggcagtacaaacaccgtccctgaacgaaggaacctgccccctgctccaaaaaggcctgcccgcctcccctataccccggcggcaagcaggacaccgcaaagaggcctcccgcgcgccctctcggatcatcatccgtcggccaaggcggcaacaacacgcggctttctttggcctcccgcgcccgccgccgccgaccgcctccttcaacccgcgcaacggcaccgtcgtcgaccgcgccgtcaccgacgcccgcaactgggacttcttcctgcaggcccacaccccgctgcacggcaccgcccgcccgggccactactaccccgtctacgacgagatcttccgctccagcgtcgtcaagccatccctggccagactgacgggtggcatcggggcgaacgtggcggatgcggtcgaggcgctgactcataatatgtgctatctgttcgggcgtgcgacgaagtcggtgagcgtgtgtcgccggcgtattatgcggatctggtctgtacgagggctaggtgttatttgagtaggttgtttgaggcggggtcggcggcggggtctgtagcggcagggtctgtggcggtgggtggtcgataaagataaagtttggaggtggggttggcgaagttgtctacggttacgccgcaggggggggagggggatggagggaatgatcagcaggaggctagggtaagtgaggtgaggatccatgagttggtgagggattcgatgttttacatttaggagggtggtttgggatgggtgaagctaggaggaattattttgttttgttttcttggatgcatgtgtattttcttctaggtataactagatgacttgttgtgttacacggtgaatctctaacgttctacttttgtcagtattacctgcattctatagggagaaattacactttatcacgaatatatctgtctgtgggaaaagtaagatgcgagaagtgttttgaggaggtacattgtacatgtacatacaattgaagtgactggtggttttggagcgagttaattcaagctaaataatcatacaacagaaccggaaattttcaagaaagggaaagatggaaagaggaagtcttgagaacaaacgggcaagaaggaagggaacaagcggataaactaaacattataaaaaacagggagcgggacagaagtaagagatgcatgtaaattcaaaagggttcgaggatagggtgacagttggttggcggtaataaaaggtgttttatggtaaacgcacaagacagatgcttaatagattaaaataaaaacggagatggacgatcttctccaattccttttgttttttatatccccctttctttttcctttgctcttctttttgg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]