GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 13:15:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_001827652             507 bp    mRNA    linear   PLN 04-APR-2018
DEFINITION  Aspergillus oryzae RIB40 unnamed protein product (AO090010000754),
            partial mRNA.
ACCESSION   XM_001827652
VERSION     XM_001827652.3
DBLINK      BioProject: PRJNA28175
            BioSample: SAMD00067075
KEYWORDS    RefSeq.
SOURCE      Aspergillus oryzae RIB40
  ORGANISM  Aspergillus oryzae RIB40
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Aspergillus; Aspergillus subgen. Circumdati.
REFERENCE   1
  AUTHORS   Machida,M., Asai,K., Sano,M., Tanaka,T., Kumagai,T., Terai,G.,
            Kusumoto,K., Arima,T., Akita,O., Kashiwagi,Y., Abe,K., Gomi,K.,
            Horiuchi,H., Kitamoto,K., Kobayashi,T., Takeuchi,M., Denning,D.W.,
            Galagan,J.E., Nierman,W.C., Yu,J., Archer,D.B., Bennett,J.W.,
            Bhatnagar,D., Cleveland,T.E., Fedorova,N.D., Gotoh,O., Horikawa,H.,
            Hosoyama,A., Ichinomiya,M., Igarashi,R., Iwashita,K., Juvvadi,P.R.,
            Kato,M., Kato,Y., Kin,T., Kokubun,A., Maeda,H., Maeyama,N.,
            Maruyama,J., Nagasaki,H., Nakajima,T., Oda,K., Okada,K.,
            Paulsen,I., Sakamoto,K., Sawano,T., Takahashi,M., Takase,K.,
            Terabayashi,Y., Wortman,J.R., Yamada,O., Yamagata,Y., Anazawa,H.,
            Hata,Y., Koide,Y., Komori,T., Koyama,Y., Minetoki,T., Suharnan,S.,
            Tanaka,A., Isono,K., Kuhara,S., Ogasawara,N. and Kikuchi,H.
  TITLE     Genome sequencing and analysis of Aspergillus oryzae
  JOURNAL   Nature 438 (7071), 1157-1161 (2005)
   PUBMED   16372010
REFERENCE   2  (bases 1 to 507)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-APR-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 507)
  AUTHORS   Fujita,N., Sawano,T., Yamada,O., Tanaka,T. and Machida,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-JUN-2011) Contact:Masayuki Machida National Institute
            of Advanced Industrial Science and Technology, Bioproduction
            Research Institute; Higashi 1-1-1, Tsukuba, Ibaraki 305-8566, Japan
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_036442).
            
            On Dec 8, 2017 this sequence version replaced XM_001827652.2.
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..507
                     /organism="Aspergillus oryzae RIB40"
                     /mol_type="mRNA"
                     /strain="RIB40"
                     /db_xref="taxon:510516"
                     /chromosome="8"
     gene            <1..>507
                     /locus_tag="AO090010000754"
                     /db_xref="GeneID:5999838"
     CDS             1..507
                     /locus_tag="AO090010000754"
                     /note="unnamed protein product; predicted protein"
                     /codon_start=1
                     /protein_id="XP_001827704.3"
                     /db_xref="GeneID:5999838"
                     /translation="
MLSMSAILTTLGLQAPPGGQASNHAVAYLLANWLISFGVFSTRREKLKLGIDHNQAPREDLAKFGEAAVQSGKITRQTLNRLKRQEAIMANSAEHYPLFVAAILVALHAGVSNDIINRIGLWYAVSRLAFGFCYKYIESLKLSFVRSVFWWSGNICCFTAFWFASKKL"
     misc_feature    73..492
                     /locus_tag="AO090010000754"
                     /note="MAPEG family; Region: MAPEG; pfam01124"
                     /db_xref="CDD:426065"
ORIGIN      
atgctcagcatgtcggccatcttgactactcttggtcttcaggctcctcccgggggacaggcctccaaccatgccgtggcttatctgctggccaactggctcatatcatttggcgtatttagcacgcggcgggagaagttgaagctcggtatcgatcacaaccaggcccctcgcgaagaccttgccaaatttggagaggcagccgtacaatcaggcaagatcacacggcaaaccttgaatcgactcaagcggcaggaagccatcatggccaattcagcggagcattacccattatttgtagctgcaatccttgtcgctcttcacgcgggtgtgtccaatgatattattaaccgcattggactatggtatgcggtatcacggctggcgttcgggttctgctacaagtacattgagtctctcaaactgagctttgttcgttcggtcttttggtggtcaggcaatatttgctgcttcaccgctttttggtttgcctcgaagaaactgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]