2024-05-18 13:15:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_001827652 507 bp mRNA linear PLN 04-APR-2018 DEFINITION Aspergillus oryzae RIB40 unnamed protein product (AO090010000754), partial mRNA. ACCESSION XM_001827652 VERSION XM_001827652.3 DBLINK BioProject: PRJNA28175 BioSample: SAMD00067075 KEYWORDS RefSeq. SOURCE Aspergillus oryzae RIB40 ORGANISM Aspergillus oryzae RIB40 Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Aspergillus; Aspergillus subgen. Circumdati. REFERENCE 1 AUTHORS Machida,M., Asai,K., Sano,M., Tanaka,T., Kumagai,T., Terai,G., Kusumoto,K., Arima,T., Akita,O., Kashiwagi,Y., Abe,K., Gomi,K., Horiuchi,H., Kitamoto,K., Kobayashi,T., Takeuchi,M., Denning,D.W., Galagan,J.E., Nierman,W.C., Yu,J., Archer,D.B., Bennett,J.W., Bhatnagar,D., Cleveland,T.E., Fedorova,N.D., Gotoh,O., Horikawa,H., Hosoyama,A., Ichinomiya,M., Igarashi,R., Iwashita,K., Juvvadi,P.R., Kato,M., Kato,Y., Kin,T., Kokubun,A., Maeda,H., Maeyama,N., Maruyama,J., Nagasaki,H., Nakajima,T., Oda,K., Okada,K., Paulsen,I., Sakamoto,K., Sawano,T., Takahashi,M., Takase,K., Terabayashi,Y., Wortman,J.R., Yamada,O., Yamagata,Y., Anazawa,H., Hata,Y., Koide,Y., Komori,T., Koyama,Y., Minetoki,T., Suharnan,S., Tanaka,A., Isono,K., Kuhara,S., Ogasawara,N. and Kikuchi,H. TITLE Genome sequencing and analysis of Aspergillus oryzae JOURNAL Nature 438 (7071), 1157-1161 (2005) PUBMED 16372010 REFERENCE 2 (bases 1 to 507) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-APR-2018) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 507) AUTHORS Fujita,N., Sawano,T., Yamada,O., Tanaka,T. and Machida,M. TITLE Direct Submission JOURNAL Submitted (03-JUN-2011) Contact:Masayuki Machida National Institute of Advanced Industrial Science and Technology, Bioproduction Research Institute; Higashi 1-1-1, Tsukuba, Ibaraki 305-8566, Japan COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_036442). On Dec 8, 2017 this sequence version replaced XM_001827652.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..507 /organism="Aspergillus oryzae RIB40" /mol_type="mRNA" /strain="RIB40" /db_xref="taxon:510516" /chromosome="8" gene <1..>507 /locus_tag="AO090010000754" /db_xref="GeneID:5999838" CDS 1..507 /locus_tag="AO090010000754" /note="unnamed protein product; predicted protein" /codon_start=1 /protein_id="XP_001827704.3" /db_xref="GeneID:5999838" /translation="
MLSMSAILTTLGLQAPPGGQASNHAVAYLLANWLISFGVFSTRREKLKLGIDHNQAPREDLAKFGEAAVQSGKITRQTLNRLKRQEAIMANSAEHYPLFVAAILVALHAGVSNDIINRIGLWYAVSRLAFGFCYKYIESLKLSFVRSVFWWSGNICCFTAFWFASKKL"
misc_feature 73..492 /locus_tag="AO090010000754" /note="MAPEG family; Region: MAPEG; pfam01124" /db_xref="CDD:426065" ORIGIN
atgctcagcatgtcggccatcttgactactcttggtcttcaggctcctcccgggggacaggcctccaaccatgccgtggcttatctgctggccaactggctcatatcatttggcgtatttagcacgcggcgggagaagttgaagctcggtatcgatcacaaccaggcccctcgcgaagaccttgccaaatttggagaggcagccgtacaatcaggcaagatcacacggcaaaccttgaatcgactcaagcggcaggaagccatcatggccaattcagcggagcattacccattatttgtagctgcaatccttgtcgctcttcacgcgggtgtgtccaatgatattattaaccgcattggactatggtatgcggtatcacggctggcgttcgggttctgctacaagtacattgagtctctcaaactgagctttgttcgttcggtcttttggtggtcaggcaatatttgctgcttcaccgctttttggtttgcctcgaagaaactgtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]