LOCUS       XM_001742171             525 bp    mRNA    linear   INV 01-MAY-2020
DEFINITION  Monosiga brevicollis MX1 uncharacterized protein
            (MONBRDRAFT_22147), partial mRNA.
ACCESSION   XM_001742171
VERSION     XM_001742171.1
DBLINK      BioProject: PRJNA28133
            BioSample: SAMN02953695
KEYWORDS    RefSeq.
SOURCE      Monosiga brevicollis MX1
  ORGANISM  Monosiga brevicollis MX1
            Eukaryota; Choanoflagellata; Craspedida; Salpingoecidae; Monosiga.
REFERENCE   1  (bases 1 to 525)
  AUTHORS   King,N., Westbrook,M.J., Young,S.L., Kuo,A., Abedin,M., Chapman,J.,
            Fairclough,S., Hellsten,U., Isogai,Y., Letunic,I., Marr,M.,
            Pincus,D., Putnam,N., Rokas,A., Wright,K.J., Zuzow,R., Dirks,W.,
            Good,M., Goodstein,D., Lemons,D., Li,W., Lyons,J.B., Morris,A.,
            Nichols,S., Richter,D.J., Salamov,A., Sequencing,J.G., Bork,P.,
            Lim,W.A., Manning,G., Miller,W.T., McGinnis,W., Shapiro,H.,
            Tjian,R., Grigoriev,I.V. and Rokhsar,D.
  TITLE     The genome of the choanoflagellate Monosiga brevicollis and the
            origin of metazoans
  JOURNAL   Nature 451 (7180), 783-788 (2008)
   PUBMED   18273011
REFERENCE   2  (bases 1 to 525)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (30-APR-2020) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 525)
  AUTHORS   Kuo,A., Salamov,A., Grigoriev,I., Zhou,K., Pitluck,S., Shapiro,H.,
            Lindquist,E., Lucas,S., Glavina del Rio,T., Abedin,M.,
            Westbrook,M.J., Young,S.L., King,N. and Rokhsar,D.S.
  CONSRTM   US DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (24-OCT-2007) US DOE Joint Genome Institute, 2800
            Mitchell Drive B100, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_001865039).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..525
                     /organism="Monosiga brevicollis MX1"
                     /mol_type="mRNA"
                     /strain="MX1"
                     /db_xref="taxon:431895"
                     /chromosome="Unknown"
     gene            <1..>525
                     /locus_tag="MONBRDRAFT_22147"
                     /db_xref="GeneID:5887523"
     CDS             1..525
                     /locus_tag="MONBRDRAFT_22147"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_001742223.1"
                     /db_xref="GeneID:5887523"
                     /translation="

MGAIPELVLVGAAGLVSWVAEVANVSEEVVAGDRLVCAAGVELVVGDGLFVEDLELMVEYELGSVEGLFDTAGLVEREAGTEEAGGPDEVDKVGEVDEVDKVGEVDEVDKVGEVDEVDKVGEVDKVGEVDEVDKVGEVDEVGEVDEVDEVDEIDAVDAVDDDTGVMGGLRRTKS"

ORIGIN      

atgggcgccattcccgagctcgtgctggtcggggcagccgggcttgtgtcatgggtggctgaggttgcaaatgtaagcgaagaggttgtcgcaggggataggcttgtgtgcgccgcaggagtggaacttgtggtgggcgatgggctatttgtggaggaccttgaactgatggtcgaatacgagctgggctcggttgaggggctgttcgacacagcagggctcgtagaaagagaagccggcacggaggaggccggcggaccagacgaggtagacaaggtgggcgaggtagacgaggtagacaaggtgggcgaggtagacgaggtagacaaggtgggcgaggtagacgaggtagacaaggtgggcgaggtagacaaggtgggcgaggtagacgaggtagacaaggtgggcgaggtagacgaggtgggcgaggtagacgaggtagacgaggtagacgagatagacgcggtagacgcggtagatgatgatacgggcgtgatgggtggcttgagaagaaccaagtcttga

//