2024-04-26 08:05:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_001729557 414 bp mRNA linear PLN 27-DEC-2023 DEFINITION Malassezia globosa CBS 7966 uncharacterized protein (MGL_3153), partial mRNA. ACCESSION XM_001729557 VERSION XM_001729557.1 DBLINK BioProject: PRJNA27973 BioSample: SAMN02953680 KEYWORDS RefSeq. SOURCE Malassezia globosa CBS 7966 ORGANISM Malassezia globosa CBS 7966 Eukaryota; Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Malasseziomycetes; Malasseziales; Malasseziaceae; Malassezia. REFERENCE 1 (bases 1 to 414) AUTHORS Xu,J., Saunders,C.W., Hu,P., Grant,R.A., Boekhout,T., Kuramae,E.E., Kronstad,J.W., Deangelis,Y.M., Reeder,N.L., Johnstone,K.R., Leland,M., Fieno,A.M., Begley,W.M., Sun,Y., Lacey,M.P., Chaudhary,T., Keough,T., Chu,L., Sears,R., Yuan,B. and Dawson,T.L. Jr. TITLE Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens JOURNAL Proc. Natl. Acad. Sci. U.S.A. 104 (47), 18730-18735 (2007) PUBMED 18000048 REFERENCE 2 (bases 1 to 414) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (27-DEC-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 414) AUTHORS Xu,J., Saunders,C., DeAngelis,Y., Reeder,N., Johnstone,K., Hu,P., Grant,R., Fieno,A., Begley,B., Sun,Y., Lacey,M.P., Keough,T.W., Boekhout,T., Kuramae,E., Kronstad,J. and Dawson,T. TITLE Direct Submission JOURNAL Submitted (29-JAN-2007) Miami Valley Innovation Center, The Procter & Gamble Company, 11810 East Miami River Road, Cincinnati, OH 45252, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_001849864). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..414 /organism="Malassezia globosa CBS 7966" /mol_type="mRNA" /strain="CBS 7966" /type_material="culture from type material of Malassezia globosa" /db_xref="taxon:425265" /chromosome="Unknown" gene <1..>414 /locus_tag="MGL_3153" /db_xref="GeneID:5853915" CDS 1..414 /locus_tag="MGL_3153" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_001729609.1" /db_xref="GeneID:5853915" /translation="
MVRFASLAVSLVTLIAAAMPSTAFDARSDLNARMVYDPKILYPTHDTVWKVGDKVNVTWRAADMPREFREYTGKVILGHIEPGSMNEHLANTLAEDFKMADGNVTFTVPHVKERDDYVVVLMGDSGNHSPKFTIRSA"
misc_feature 127..402 /locus_tag="MGL_3153" /note="Ser-Thr-rich glycosyl-phosphatidyl-inositol-anchored membrane family; Region: GPI-anchored; pfam10342" /db_xref="CDD:431221" ORIGIN
atggttcgcttcgcatcgctggctgtttcgcttgtcactcttatcgctgctgctatgccaagcacggcatttgatgctcgcagcgacctcaacgcgcgaatggtttatgacccgaagattctctacccgacgcacgatactgtgtggaaggtgggcgacaaggtcaacgtgacctggcgtgctgctgacatgcctcgcgaatttagggaatacacgggtaaggttattcttggacacattgagcctggctcaatgaatgaacatctggcgaacacgctcgccgaagacttcaaaatggccgatggtaacgtgacctttacagtgccgcacgtaaaggaacgcgatgactacgtggtggtgctgatgggagactctggcaaccactcacctaagtttaccatccgctccgcttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]