GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-15 22:44:38, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_001729557             414 bp    mRNA    linear   PLN 27-DEC-2023
DEFINITION  Malassezia globosa CBS 7966 uncharacterized protein (MGL_3153),
            partial mRNA.
ACCESSION   XM_001729557
VERSION     XM_001729557.1
DBLINK      BioProject: PRJNA27973
            BioSample: SAMN02953680
KEYWORDS    RefSeq.
SOURCE      Malassezia globosa CBS 7966
  ORGANISM  Malassezia globosa CBS 7966
            Eukaryota; Fungi; Dikarya; Basidiomycota; Ustilaginomycotina;
            Malasseziomycetes; Malasseziales; Malasseziaceae; Malassezia.
REFERENCE   1  (bases 1 to 414)
  AUTHORS   Xu,J., Saunders,C.W., Hu,P., Grant,R.A., Boekhout,T., Kuramae,E.E.,
            Kronstad,J.W., Deangelis,Y.M., Reeder,N.L., Johnstone,K.R.,
            Leland,M., Fieno,A.M., Begley,W.M., Sun,Y., Lacey,M.P.,
            Chaudhary,T., Keough,T., Chu,L., Sears,R., Yuan,B. and Dawson,T.L.
            Jr.
  TITLE     Dandruff-associated Malassezia genomes reveal convergent and
            divergent virulence traits shared with plant and human fungal
            pathogens
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 104 (47), 18730-18735 (2007)
   PUBMED   18000048
REFERENCE   2  (bases 1 to 414)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (27-DEC-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 414)
  AUTHORS   Xu,J., Saunders,C., DeAngelis,Y., Reeder,N., Johnstone,K., Hu,P.,
            Grant,R., Fieno,A., Begley,B., Sun,Y., Lacey,M.P., Keough,T.W.,
            Boekhout,T., Kuramae,E., Kronstad,J. and Dawson,T.
  TITLE     Direct Submission
  JOURNAL   Submitted (29-JAN-2007) Miami Valley Innovation Center, The Procter
            & Gamble Company, 11810 East Miami River Road, Cincinnati, OH
            45252, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_001849864).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..414
                     /organism="Malassezia globosa CBS 7966"
                     /mol_type="mRNA"
                     /strain="CBS 7966"
                     /type_material="culture from type material of Malassezia
                     globosa"
                     /db_xref="taxon:425265"
                     /chromosome="Unknown"
     gene            <1..>414
                     /locus_tag="MGL_3153"
                     /db_xref="GeneID:5853915"
     CDS             1..414
                     /locus_tag="MGL_3153"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_001729609.1"
                     /db_xref="GeneID:5853915"
                     /translation="
MVRFASLAVSLVTLIAAAMPSTAFDARSDLNARMVYDPKILYPTHDTVWKVGDKVNVTWRAADMPREFREYTGKVILGHIEPGSMNEHLANTLAEDFKMADGNVTFTVPHVKERDDYVVVLMGDSGNHSPKFTIRSA"
ORIGIN      
atggttcgcttcgcatcgctggctgtttcgcttgtcactcttatcgctgctgctatgccaagcacggcatttgatgctcgcagcgacctcaacgcgcgaatggtttatgacccgaagattctctacccgacgcacgatactgtgtggaaggtgggcgacaaggtcaacgtgacctggcgtgctgctgacatgcctcgcgaatttagggaatacacgggtaaggttattcttggacacattgagcctggctcaatgaatgaacatctggcgaacacgctcgccgaagacttcaaaatggccgatggtaacgtgacctttacagtgccgcacgtaaaggaacgcgatgactacgtggtggtgctgatgggagactctggcaaccactcacctaagtttaccatccgctccgcttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]