2024-04-20 14:47:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_001599656 1309 bp mRNA linear INV 29-FEB-2020 DEFINITION PREDICTED: Nasonia vitripennis uroporphyrinogen-III synthase (LOC100114801), mRNA. ACCESSION XM_001599656 VERSION XM_001599656.6 DBLINK BioProject: PRJNA594415 KEYWORDS RefSeq. SOURCE Nasonia vitripennis (jewel wasp) ORGANISM Nasonia vitripennis Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Proctotrupomorpha; Chalcidoidea; Pteromalidae; Pteromalinae; Nasonia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045760.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 29, 2020 this sequence version replaced XM_001599656.5. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Nasonia vitripennis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1309 /organism="Nasonia vitripennis" /mol_type="mRNA" /strain="AsymCx" /db_xref="taxon:7425" /chromosome="4" /map="unlocalized" /sex="male" /tissue_type="whole animal" /dev_stage="adult" /genotype="PSR+" gene 1..1309 /gene="LOC100114801" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 ESTs, 221 long SRA reads, 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 111 samples with support for all annotated introns" /db_xref="GeneID:100114801" /db_xref="NASONIABASE:NV17927" CDS 296..1075 /gene="LOC100114801" /codon_start=1 /product="uroporphyrinogen-III synthase" /protein_id="XP_001599706.1" /db_xref="GeneID:100114801" /db_xref="NASONIABASE:NV17927" /translation="
MSINKIKVLLCTGVSSETDNNENQYKKCLTEHGFECEILQVLHFEFINLDDLRNTLLDSESYNGLILTSPRAAAAIAMTKMQNPFSLEPWLEKTTFCIGQATEFVAKEQVGLTNIFGSDSGNAKNLANFIVHTMKEKCKKPLLLPCSDIARDTIPQILLNNKIEVKKIVVYKTKAHHFLAEALNEALNQSPHVLVFYSPSIVDNMLNALSNNKTIFENFKIIAIGPVTEEALENAGIKVDGVAEKPEPTSLTEVIQKII"
misc_feature 365..1060 /gene="LOC100114801" /note="Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578" /db_xref="CDD:119440" misc_feature order(500..508,596..598,734..736,806..808,812..814, 884..898) /gene="LOC100114801" /note="active site" /db_xref="CDD:119440" ORIGIN
gcaaataagtatcgattattaccatacaattcaaatttaaacatttttataggttaaattttgagcaggtgtgttccttcgtttcaactgcagtctgctacagtggattggcagtactgcccaaaacgttatgttctacgtaaaccccttgtaaaccctaacgtatacgctcaattgtggacgcaccctgaataatttagcgaactttctgtacataacctacaatgtttaagcggttggcactagataaatactaatagagctgagtttggattttgcatttacaaatctcaaaatgtctattaataaaataaaagttttattatgtaccggagtttcaagtgagacagataacaatgaaaatcagtataaaaaatgtcttacagaacatggctttgaatgtgaaatattgcaagtgctacattttgaatttattaatctagatgatttacgcaatactttgcttgattcggaatcttataatggtttaatactaacaagtccaagagcagctgcagctatagctatgacaaaaatgcaaaatccattttccttggaaccatggctagaaaaaacaacattttgtattggtcaggctacagaatttgttgcaaaggaacaagttgggttaactaatatatttggttctgattctgggaatgccaagaacttagctaatttcattgtacacactatgaaagaaaaatgtaaaaagccactactacttccatgcagtgatattgcaagagatacaataccacaaattttattaaacaataaaatagaagtaaaaaaaattgttgtatataaaacaaaagctcatcattttttagcagaagcattaaatgaagctttaaaccaatcaccacatgttttagtattctatagtccatcaattgtagataatatgttgaatgccttatctaataataagactatatttgaaaatttcaaaattattgcaattggtcctgttactgaagaagctttagaaaatgcaggaatcaaagttgatggagtagctgaaaaaccagaacctacatccttgactgaagtcatacagaaaatcatttaattgcgaagttaggttttgttcataatgaagacaaattatgaagcactgattacatattaatttttgtttatttatgtaaatattttatacatatcgtaatttttataactttaatgaattttaaaattctctatggtaaattgtacatatttttaagaattatacatgccacataaatcttataaattaaaatgtgtattttattttttgataaaagcatcaattctgaaaata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]