LOCUS       NR_177986               2560 bp    RNA     linear   ROD 27-JUN-2023
DEFINITION  Mus musculus amyloid beta precursor protein binding family B member
            1 (Apbb1), transcript variant 12, non-coding RNA.
ACCESSION   NR_177986
VERSION     NR_177986.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2560)
  AUTHORS   Strecker P, Ludewig S, Rust M, Mundinger TA, Gorlich A, Krachan EG,
            Mehrfeld C, Herz J, Korte M, Guenette SY and Kins S.
  TITLE     FE65 and FE65L1 share common synaptic functions and genetically
            interact with the APP family in neuromuscular junction formation
  JOURNAL   Sci Rep 6, 25652 (2016)
   PUBMED   27734846
  REMARK    GeneRIF: These data demonstrate a role for FE65 proteins at central
            and peripheral synapses.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2560)
  AUTHORS   Lee HJ, Yoon JH, Ahn JS, Jo EH, Kim MY, Lee YC, Kim JW, Ann EJ and
            Park HS.
  TITLE     Fe65 negatively regulates Jagged1 signaling by decreasing Jagged1
            protein stability through the E3 ligase Neuralized-like 1
  JOURNAL   Biochim Biophys Acta 1853 (11 Pt A), 2918-2928 (2015)
   PUBMED   26276215
  REMARK    GeneRIF: Jagged1 is a novel binding partner of Fe65, and Fe65 may
            act as a novel effector of Jagged1 signaling.
REFERENCE   3  (bases 1 to 2560)
  AUTHORS   Durst R, Sauls K, Peal DS, deVlaming A, Toomer K, Leyne M, Salani
            M, Talkowski ME, Brand H, Perrocheau M, Simpson C, Jett C, Stone
            MR, Charles F, Chiang C, Lynch SN, Bouatia-Naji N, Delling FN,
            Freed LA, Tribouilloy C, Le Tourneau T, LeMarec H, Fernandez-Friera
            L, Solis J, Trujillano D, Ossowski S, Estivill X, Dina C, Bruneval
            P, Chester A, Schott JJ, Irvine KD, Mao Y, Wessels A, Motiwala T,
            Puceat M, Tsukasaki Y, Menick DR, Kasiganesan H, Nie X, Broome AM,
            Williams K, Johnson A, Markwald RR, Jeunemaitre X, Hagege A, Levine
            RA, Milan DJ, Norris RA and Slaugenhaupt SA.
  TITLE     Mutations in DCHS1 cause mitral valve prolapse
  JOURNAL   Nature 525 (7567), 109-113 (2015)
   PUBMED   26258302
REFERENCE   4  (bases 1 to 2560)
  AUTHORS   Ryu S, Teles F, Minopoli G, Russo T, Rosenfeld MG and Suh Y.
  TITLE     An epigenomic role of Fe65 in the cellular response to DNA damage
  JOURNAL   Mutat Res 776, 40-47 (2015)
   PUBMED   26255939
  REMARK    GeneRIF: results provide strong evidence that Fe65 plays a role in
            DNA damage response and cell viability by epigenomic regulation of
            specific transcriptional programs activated upon genotoxic stress.
REFERENCE   5  (bases 1 to 2560)
  AUTHORS   Suh J, Moncaster JA, Wang L, Hafeez I, Herz J, Tanzi RE, Goldstein
            LE and Guenette SY.
  TITLE     FE65 and FE65L1 amyloid precursor protein-binding protein compound
            null mice display adult-onset cataract and muscle weakness
  JOURNAL   FASEB J 29 (6), 2628-2639 (2015)
   PUBMED   25757569
  REMARK    GeneRIF: Findings show that amyloid precursor protein-binding
            proteins FE65 and FE65L1 are essential for the maintenance of lens
            transparency.
REFERENCE   6  (bases 1 to 2560)
  AUTHORS   Pappolla MA, Chyan YJ, Omar RA, Hsiao K, Perry G, Smith MA and
            Bozner P.
  TITLE     Evidence of oxidative stress and in vivo neurotoxicity of
            beta-amyloid in a transgenic mouse model of Alzheimer's disease: a
            chronic oxidative paradigm for testing antioxidant therapies in
            vivo
  JOURNAL   Am J Pathol 152 (4), 871-877 (1998)
   PUBMED   9546346
REFERENCE   7  (bases 1 to 2560)
  AUTHORS   Ermekova KS, Zambrano N, Linn H, Minopoli G, Gertler F, Russo T and
            Sudol M.
  TITLE     The WW domain of neural protein FE65 interacts with proline-rich
            motifs in Mena, the mammalian homolog of Drosophila enabled
  JOURNAL   J Biol Chem 272 (52), 32869-32877 (1997)
   PUBMED   9407065
REFERENCE   8  (bases 1 to 2560)
  AUTHORS   Brady KP, Rowe LB, Her H, Stevens TJ, Eppig J, Sussman DJ, Sikela J
            and Beier DR.
  TITLE     Genetic mapping of 262 loci derived from expressed sequences in a
            murine interspecific cross using single-strand conformational
            polymorphism analysis
  JOURNAL   Genome Res 7 (11), 1085-1093 (1997)
   PUBMED   9371744
REFERENCE   9  (bases 1 to 2560)
  AUTHORS   Bressler SL, Gray MD, Sopher BL, Hu Q, Hearn MG, Pham DG, Dinulos
            MB, Fukuchi K, Sisodia SS, Miller MA, Disteche CM and Martin GM.
  TITLE     cDNA cloning and chromosome mapping of the human Fe65 gene:
            interaction of the conserved cytoplasmic domains of the human
            beta-amyloid precursor protein and its homologues with the mouse
            Fe65 protein
  JOURNAL   Hum Mol Genet 5 (10), 1589-1598 (1996)
   PUBMED   8894693
REFERENCE   10 (bases 1 to 2560)
  AUTHORS   Simeone A, Duilio A, Fiore F, Acampora D, De Felice C, Faraonio R,
            Paolocci F, Cimino F and Russo T.
  TITLE     Expression of the neuron-specific FE65 gene marks the development
            of embryo ganglionic derivatives
  JOURNAL   Dev Neurosci 16 (1-2), 53-60 (1994)
   PUBMED   7867517
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC125227.6.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR17784649.299204.1,
                                           SRR7974084.20735.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164131, SAMN01164139
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-84                AC125227.6         92433-92516         c
            85-819              AC125227.6         84980-85714         c
            820-995             AC125227.6         78876-79051         c
            996-1052            AC125227.6         78726-78782         c
            1053-1138           AC125227.6         78552-78637         c
            1139-1288           AC125227.6         77846-77995         c
            1289-1416           AC125227.6         77349-77476         c
            1417-1531           AC125227.6         76831-76945         c
            1532-1616           AC125227.6         76599-76683         c
            1617-1700           AC125227.6         76270-76353         c
            1701-1816           AC125227.6         70741-70856         c
            1817-1993           AC125227.6         70430-70606         c
            1994-2560           AC125227.6         69782-70348         c
FEATURES             Location/Qualifiers
     source          1..2560
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 55.9 cM"
     gene            1..2560
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /note="amyloid beta precursor protein binding family B
                     member 1"
                     /db_xref="GeneID:11785"
                     /db_xref="MGI:MGI:107765"
     misc_RNA        1..2560
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /product="amyloid beta precursor protein binding family B
                     member 1, transcript variant 12"
                     /db_xref="GeneID:11785"
                     /db_xref="MGI:MGI:107765"
     exon            1..84
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            85..819
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    99..1160
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001253885.2"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            820..995
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            996..1052
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1053..1138
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1139..1288
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1289..1416
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1417..1531
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1532..1616
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1617..1700
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1701..1816
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1817..1993
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
     exon            1994..2560
                     /gene="Apbb1"
                     /gene_synonym="Fe65; Rir"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gttgtgatggagaagctgcggtgttgcgggagccttgcagcttgagctaccttcgccacctgggcctggggcctcgccgcgcaggatctaccaaggccatgtctgttccatcatccctgagccagtcggccattaacgctaacagccacggaggccctgcactcagcttccccttacccctgcacgctgcccataaccagctgctcaacgccaagctgcaagccacagctgtggtacccaaggaccttcgaagtgctatgggagagggtagtgtgcctgaaccaggccctgccaatgccaagtggttaaaggaaggccagaaccagcttcggagggctgccacagcccaccgagaccagaaccgaaatgtgaccttgaccttggcggaggaggccagccaggaggctgagacggcacctttgggtcccaaaggcttaatgcatctatactctgagctggagctctcggcccacaatgcagccaaccgagggcttcatggatccgccttgatcatcaacacccaggaacagggaccagatgaaggagaggagaaggcagcaggagaggctgaggaggatgatgaagacgaagaggaggaggaggaggaggaggacttgtcttctcctccagggctacctgagcctctggagaatgtggaagtcccctctgggccccaggccctcacagacggcccccgggaacacagcaagagtgctagcctcctatttggcatgcgaaacagtgcagccagtgatgaggactcaagctgggccaccttatcacagggcagcccctcctatggctccccggaggacacagattccttctggaaccccaacgctttcgagacggattccgatctaccggctggatggatgagggtacaggacacctcagggacctactactggcacatcccaacagggaccacccagtgggaacccccaggccgggcctccccctcacaggggagcagcccccaagaagagtcccagctcacctggactggctttgctcaccaagaaggctttgaggaaggagagttttggaaggatgaacccagtgaggaggccccaatggagttgggactgaaggaccccgaggaggcgacattgtccttcccagctcagagcctcagtgtttcgctgtgcgctccctaggctgggtagagatgaccgaggaggagctggccccaggacgcagcagtgtggcagtcaacaattgtatccgccagctctcctaccacaaaaacaatctacatgatccgatggctgggggctggggagagggaaaggatctgctgctccagctggaggacgagactctaaagttggtggagccacagaaccagacgctgctgcatgcacagcccatcgtcagcattcgtgtgtggggcgttgggcgggacagtggaagggactttgcctacgtagctcgagataagctgacccagatgctcaagtgccacgtgtttcgctgtgaggcacctgccaagaacatcgccaccagcctgcatgagatctgctccaagatcatgtctgaacggcgcaatgctcgctgcttggtcaatggactctccctagaccactctaaactcgtggatgtccctttccaagtggaattcccagcaccaaagaatgagctggtgcagaagttccaagtctattacctgggaaatgtgccagttgctaaacctgttggggtagacgtgattaatggggccctggagtcagtcctgtcttccagtagccgtgagcagtggactccaagtcacgtcagcgtggcccctgccaccctcaccatcttgcaccagcagacagaagcggtgctgggggagtgccgggtgcggtttctctccttcctggctgtgggcagagatgtgcacacattcgcgttcatcatggctgccggcccagcctccttctgctgtcacatgttttggtgtgagcccaatgctgccagtctctcagaggctgtgcaggctgcatgcatgctccgctaccagaagtgtctggatgctcgctcccagacctccacctcctgcctcccagcaccccctgcggagtcagttgcaagacgtgtagggtggacagtccgcaggggtgttcagtcgctgtggggttccctcaagcccaaacgtctgggatcccagaccccatgaagaactcccatccttcctctgcctgcttgtttggggccccagggaactcaagggtttggggcaggtaggggctgtggatgttcttcctacaccccacgtcccctgggctgcccttcctcagtagctggggttccctacctaggggctgggagagagaaattgaattccttcacagaagtcattacactggactgatgacatgaggggccagaagcaaagccagccttgggctctccatccccagtgtttgaggtagagcaagaggaactggtccaagccaggccccatcctcaaaggcccagcaggggcaggagaggactggtctcatggatcccctctcccctgttctgcgggcacctccgctgtactgatatcactaataaagtctgtctgcgctgc

//