GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:38:55, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_152602               2278 bp    RNA     linear   PRI 01-MAR-2020
DEFINITION  Homo sapiens long intergenic non-protein coding RNA, regulator of
            reprogramming (LINC-ROR), transcript variant 2, long non-coding
            RNA.
ACCESSION   NR_152602
VERSION     NR_152602.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2278)
  AUTHORS   Ji Z, Chi J, Sun H, Ru A, Ni T, Zhang J, Jiang F, Lv H, Peng F, Guo
            H and Chen Y.
  TITLE     Linc-ROR targets FGF2 to regulate HASMC proliferation and migration
            via sponging miR-195-5p
  JOURNAL   Gene 725, 144143 (2020)
   PUBMED   31629816
  REMARK    GeneRIF: Mechanistic functional studies revealed that linc-ROR
            promoted HASMC proliferation and migration via regulating
            miR-195-5p/FGF2 axis.
REFERENCE   2  (bases 1 to 2278)
  AUTHORS   He X, Yu J, Xiong L, Liu Y, Fan L, Li Y, Chen B, Chen J and Xu X.
  TITLE     Exosomes derived from liver cancer cells reprogram biological
            behaviors of LO2 cells by transferring Linc-ROR
  JOURNAL   Gene 719, 144044 (2019)
   PUBMED   31400406
  REMARK    GeneRIF: Our experiments indicated the HepG2 cells could transfer
            its Linc-ROR to the LO2 cells via exosomes, then influenced the
            recipient cells
REFERENCE   3  (bases 1 to 2278)
  AUTHORS   Shi J, Zhang D, Zhong Z and Zhang W.
  TITLE     lncRNA ROR promotes the progression of renal cell carcinoma through
            the miR206/VEGF axis
  JOURNAL   Mol Med Rep 20 (4), 3782-3792 (2019)
   PUBMED   31485634
  REMARK    GeneRIF: The results of the present study revealed that lincRNA-RoR
            was upregulated in renal cell carcinoma tissues, which promoted
            tumor progression by regulating the miR206/VEGF axis.
REFERENCE   4  (bases 1 to 2278)
  AUTHORS   Toraih EA, El-Wazir A, Hussein MH, Khashana MS, Matter A, Fawzy MS
            and Hosny S.
  TITLE     Expression of long intergenic non-coding RNA, regulator of
            reprogramming, and its prognostic value in patients with
            glioblastoma
  JOURNAL   Int. J. Biol. Markers 34 (1), 69-79 (2019)
   PUBMED   30852975
  REMARK    GeneRIF: High LINC-ROR expression is associated with glioblastoma.
REFERENCE   5  (bases 1 to 2278)
  AUTHORS   Lu R, Chen J, Kong L and Zhu H.
  TITLE     Prognostic value of lncRNA ROR expression in various cancers: a
            meta-analysis
  JOURNAL   Biosci. Rep. 38 (5) (2018)
   PUBMED   30076198
  REMARK    GeneRIF: High lncRNA ROR expression was associated with worse
            prognosis in cancers. [meta-analysis]
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2278)
  AUTHORS   Takahashi K, Yan IK, Haga H and Patel T.
  TITLE     Modulation of hypoxia-signaling pathways by extracellular linc-RoR
  JOURNAL   J. Cell. Sci. 127 (Pt 7), 1585-1594 (2014)
   PUBMED   24463816
REFERENCE   7  (bases 1 to 2278)
  AUTHORS   Cheng EC and Lin H.
  TITLE     Repressing the repressor: a lincRNA as a MicroRNA sponge in
            embryonic stem cell self-renewal
  JOURNAL   Dev. Cell 25 (1), 1-2 (2013)
   PUBMED   23597480
REFERENCE   8  (bases 1 to 2278)
  AUTHORS   Wang Y, Xu Z, Jiang J, Xu C, Kang J, Xiao L, Wu M, Xiong J, Guo X
            and Liu H.
  TITLE     Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2
            in human embryonic stem cell self-renewal
  JOURNAL   Dev. Cell 25 (1), 69-80 (2013)
   PUBMED   23541921
  REMARK    GeneRIF: Linc-RoR expression is positively correlated with the
            undifferentiated embryonic stem cell state.
REFERENCE   9  (bases 1 to 2278)
  AUTHORS   Zhang A, Zhou N, Huang J, Liu Q, Fukuda K, Ma D, Lu Z, Bai C,
            Watabe K and Mo YY.
  TITLE     The human long non-coding RNA-RoR is a p53 repressor in response to
            DNA damage
  JOURNAL   Cell Res. 23 (3), 340-350 (2013)
   PUBMED   23208419
REFERENCE   10 (bases 1 to 2278)
  AUTHORS   Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, Garber
            M, Curran M, Onder T, Agarwal S, Manos PD, Datta S, Lander ES,
            Schlaeger TM, Daley GQ and Rinn JL.
  TITLE     Large intergenic non-coding RNA-RoR modulates reprogramming of
            human induced pluripotent stem cells
  JOURNAL   Nat. Genet. 42 (12), 1113-1117 (2010)
   PUBMED   21057500
  REMARK    Erratum:[Nat Genet. 2010 Dec;42(12): 3 p following 1117]
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AB908956.1, LC027886.1 and
            AI340242.1.
            
            Summary: This gene produces a long non-coding RNA that regulates
            the reprogramming of pluripotent stem cells. This RNA suppresses
            induction of tumor protein p53 after DNA damage. It is thought to
            act as a sponge for microRNAs that regulate stem cell factors POU
            class 5 homeobox 1, Nanog, and SRY-box 2. This RNA may also have a
            extracellular role in modulating response to hypoxia in
            hepatocellular cancer cells. Expression of this transcript is
            associated with tumor progression and epithelial to mesenchymal
            transition and metastasis. [provided by RefSeq, Dec 2017].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: LC027886.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-60                AB908956.1         1-60
            61-2246             LC027886.1         1-2186
            2247-2278           AI340242.1         1-32                c
FEATURES             Location/Qualifiers
     source          1..2278
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q21.31"
     gene            1..2278
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /note="long intergenic non-protein coding RNA, regulator
                     of reprogramming"
                     /db_xref="GeneID:100885779"
                     /db_xref="HGNC:HGNC:43773"
                     /db_xref="MIM:615173"
     ncRNA           1..2278
                     /ncRNA_class="lncRNA"
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /product="long intergenic non-protein coding RNA,
                     regulator of reprogramming, transcript variant 2"
                     /db_xref="GeneID:100885779"
                     /db_xref="HGNC:HGNC:43773"
                     /db_xref="MIM:615173"
     exon            1..216
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315017665"
     variation       18
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215666891"
     variation       22
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545140740"
     variation       23..36
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ct"
                     /replace="ctcacacaaagcct"
                     /db_xref="dbSNP:1462803840"
     variation       24
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305854970"
     variation       33
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308528201"
     variation       34
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051852791"
     variation       36
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997651449"
     variation       37
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344535048"
     variation       42
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236671466"
     variation       54
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898010617"
     variation       56
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186490309"
     variation       57
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539410766"
     variation       60
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427437411"
     variation       61
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34531088"
     variation       62
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431039109"
     variation       63
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147929336"
     variation       66
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467875554"
     variation       68
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335225248"
     variation       72
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889048467"
     variation       79
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144776454"
     variation       80
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568045900"
     variation       84
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930311575"
     variation       86
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360447869"
     variation       87
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574263862"
     variation       88
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325998788"
     variation       91
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:369566490"
     variation       92
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937082371"
     variation       97
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419745567"
     variation       104
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317300116"
     variation       108..111
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="gaga"
                     /replace="gagaga"
                     /db_xref="dbSNP:745422140"
     variation       108
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949776851"
     variation       109
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:928346264"
     variation       115
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555831650"
     variation       116
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918120402"
     variation       117
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:12455107"
     variation       118
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967154179"
     variation       120
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270408730"
     variation       122
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479287879"
     variation       134..136
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:938137256"
     variation       138
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926882408"
     variation       141
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569926553"
     variation       142
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968491700"
     variation       150
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551430161"
     variation       152
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343987880"
     variation       160
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020945430"
     variation       163
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262403555"
     variation       176
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215966998"
     variation       178
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303895419"
     variation       182
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988214199"
     variation       196
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:966080716"
     variation       200
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374265288"
     variation       205
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225304069"
     variation       208
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913084777"
     variation       215
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990454739"
     exon            217..410
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       217
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200709289"
     variation       219
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251130388"
     variation       225
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192538678"
     variation       227
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159110445"
     variation       231
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74382330"
     variation       232
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926163669"
     variation       233
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240942842"
     variation       234
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390962674"
     variation       235
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387756648"
     variation       237
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369510210"
     variation       240
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572788660"
     variation       241
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318833637"
     variation       242..243
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1260413652"
     variation       243
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979407384"
     variation       248
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345235285"
     variation       252
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377125467"
     variation       264
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381975980"
     variation       265
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920925212"
     variation       269
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538193382"
     variation       270
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965046401"
     variation       271
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331924519"
     variation       273
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983731936"
     variation       281
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180437801"
     variation       290..295
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1300403883"
     variation       294
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368741377"
     variation       295
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459114857"
     variation       298
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229289193"
     variation       306
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568045315"
     variation       310..316
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tctt"
                     /replace="tcttctt"
                     /db_xref="dbSNP:981864480"
     variation       313
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186682482"
     variation       314
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:527588124"
     variation       315
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376142866"
     variation       316
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952635745"
     variation       317
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026848056"
     variation       321
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291617713"
     variation       324
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558051786"
     variation       325
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539376122"
     variation       326
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023474182"
     variation       334
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297453216"
     variation       338
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427577991"
     variation       339
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256244293"
     variation       340
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424978710"
     variation       345
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391994981"
     variation       346
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182511228"
     variation       349
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1416655784"
     variation       349
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011659024"
     variation       350
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565994970"
     variation       352
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547262594"
     variation       354
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460925848"
     variation       355
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188951776"
     variation       356
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529127279"
     variation       360
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998753561"
     variation       361
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355034795"
     variation       367
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204940936"
     variation       375
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891053912"
     variation       376
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305480293"
     variation       378
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567815362"
     variation       379
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277148458"
     variation       380
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229822993"
     variation       382
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486382942"
     variation       383
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549471036"
     variation       384
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1256441817"
     variation       386
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488413118"
     variation       389
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187843496"
     variation       390
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282519037"
     variation       392
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170401149"
     variation       407
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:932308796"
     exon            411..466
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       424..425
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1211102291"
     variation       434
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007026595"
     variation       438
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181416096"
     variation       440
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424225450"
     variation       444
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478786441"
     variation       459
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168225847"
     variation       462
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399305282"
     variation       466
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422360118"
     exon            467..595
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       470..474
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1234395913"
     variation       472
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275401558"
     variation       473
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4801075"
     variation       475..478
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1043308940"
     variation       477
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8095898"
     variation       481
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181642704"
     variation       493
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054850689"
     variation       494
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463261012"
     variation       496
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355957271"
     variation       497
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939205105"
     variation       499
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746790411"
     variation       501
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260926433"
     variation       502
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866257935"
     variation       506
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946057414"
     variation       510
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477457118"
     variation       521
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158877089"
     variation       524
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527812935"
     variation       525
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548753640"
     variation       526
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157579598"
     variation       528
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350647662"
     variation       534
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1387893656"
     variation       541
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325888402"
     variation       542
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990127487"
     variation       551..552
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1301979290"
     variation       552
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536493097"
     variation       557
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957339352"
     variation       573
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018322920"
     variation       577
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1238011715"
     variation       578
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569324977"
     variation       580
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006889502"
     variation       583
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356899692"
     variation       587
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955480269"
     variation       590..593
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1467863355"
     variation       591
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1211576668"
     variation       594
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287387017"
     exon            596..2278
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       596
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001730040"
     variation       597
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293800556"
     variation       602
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:939134201"
     variation       609
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226514440"
     variation       613
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568041533"
     variation       614
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429548507"
     variation       615
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345035102"
     variation       625
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927724283"
     variation       626
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256215822"
     variation       631
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904676900"
     variation       657
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043215897"
     variation       659
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256217380"
     variation       660
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6566851"
     variation       664
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195037820"
     variation       674
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6566850"
     variation       676
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427094202"
     variation       678
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562584326"
     variation       680
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176285092"
     variation       681
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378392112"
     variation       684
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1467802829"
     variation       685
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041450572"
     variation       694
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944045541"
     variation       705
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479526417"
     variation       708
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181906570"
     variation       717..719
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1192064064"
     variation       719
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867537510"
     variation       721
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112391050"
     variation       722
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367857887"
     variation       728
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1381421666"
     variation       730
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919779064"
     variation       736
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:573557287"
     variation       739
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972501615"
     variation       740
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113761454"
     variation       744
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221585234"
     variation       749
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911260365"
     variation       760
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76248969"
     variation       768
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265946362"
     variation       769
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138434751"
     variation       773
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186253464"
     variation       778
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029728517"
     variation       779
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117346350"
     variation       780
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435069819"
     variation       800
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961535935"
     variation       801
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172014626"
     variation       805
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017204021"
     variation       812
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369923413"
     variation       815
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150898582"
     variation       818
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420371937"
     variation       822
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160587231"
     variation       830
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033455960"
     variation       835
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005766220"
     variation       842
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293836125"
     variation       846
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437764931"
     variation       850
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895394295"
     variation       851
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377241972"
     variation       856
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033375786"
     variation       860
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568041465"
     variation       864
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283297554"
     variation       865
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315603155"
     variation       867
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967764965"
     variation       870
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003194473"
     variation       873
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021802850"
     variation       884
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192218233"
     variation       899
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468698127"
     variation       903
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361028109"
     variation       904
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176904693"
     variation       907
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427929285"
     variation       911
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:906295350"
     variation       912
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042110493"
     variation       914
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418358417"
     variation       915
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116530811"
     variation       916
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188460710"
     variation       918
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:892075390"
     variation       922
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557551927"
     variation       923..926
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1400521598"
     variation       923
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008668134"
     variation       934
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448561568"
     variation       939
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187966071"
     variation       941
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371989364"
     variation       954
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228464933"
     variation       956
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314052452"
     variation       966
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201768168"
     variation       969..1044
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaattctatgactggaaagttttgggcagagttggacatgtgcactta
                     gcttccagaagacagaatccttttaaaa"
                     /replace="aaattctatgactggaaagttttgggcagagttggacatgtgcactta
                     gcttccagaagacagaatccttttaaaaaattctatgactggaaagttttgggcagag
                     ttggacatgtgcacttagcttccagaagacagaatccttttaaaa"
                     /db_xref="dbSNP:1568041420"
     variation       972
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324082071"
     variation       985
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049693398"
     variation       993
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931401399"
     variation       1000
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053547236"
     variation       1007..1010
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1231457665"
     variation       1007
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200759561"
     variation       1008
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943323174"
     variation       1011
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469677996"
     variation       1012
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910456486"
     variation       1025
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305215414"
     variation       1055
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415834276"
     variation       1061
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898551937"
     variation       1064
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163879478"
     variation       1069
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568041414"
     variation       1070
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297303404"
     variation       1082
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424088839"
     variation       1087
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985888308"
     variation       1088
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571731694"
     variation       1090
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141593913"
     variation       1091
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577775098"
     variation       1098
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314782199"
     variation       1101
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571414482"
     variation       1110
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450838450"
     variation       1115
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448081349"
     variation       1117
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381978746"
     variation       1120
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357857280"
     variation       1128
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293006718"
     variation       1130
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763379470"
     variation       1137
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768942247"
     variation       1146
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220924818"
     variation       1150
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271114121"
     variation       1156
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939868982"
     variation       1169
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:199758080"
     variation       1170..1171
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:11334455"
     variation       1181
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992077935"
     variation       1183
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961538859"
     variation       1188
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017149955"
     variation       1189
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352820051"
     variation       1190
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484611862"
     variation       1198
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1187152930"
     variation       1205
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551558951"
     variation       1206
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478677058"
     variation       1213
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73958836"
     variation       1216
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1418319836"
     variation       1219
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979051647"
     variation       1221
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469552707"
     variation       1225
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:967797545"
     variation       1229
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384440601"
     variation       1231
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181535181"
     variation       1232
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1413701636"
     variation       1234
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425263266"
     variation       1235
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312803827"
     variation       1240
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341726172"
     variation       1244
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256813973"
     variation       1247
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433300337"
     variation       1252
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772735882"
     variation       1254
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338939372"
     variation       1255
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764682208"
     variation       1259
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282491112"
     variation       1267
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868109882"
     variation       1272
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041353"
     variation       1280
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528510196"
     variation       1286
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:906165191"
     variation       1293
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263773500"
     variation       1296
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358303617"
     variation       1298
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956213567"
     variation       1305
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020172490"
     variation       1322
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566416809"
     variation       1328..1332
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="actca"
                     /db_xref="dbSNP:1478110691"
     variation       1334
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548218101"
     variation       1345
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009358228"
     variation       1349
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392956324"
     variation       1353
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893548515"
     variation       1364
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1158778804"
     variation       1371
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185165660"
     variation       1372
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562510833"
     variation       1374
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1893445"
     variation       1380
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326223423"
     variation       1391
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776308571"
     variation       1395
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437703097"
     variation       1396
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181163494"
     variation       1402
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1305893023"
     variation       1403
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051656183"
     variation       1408
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369101932"
     variation       1412
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233627454"
     variation       1420
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189520737"
     variation       1423
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203315260"
     variation       1427
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:933990549"
     variation       1433
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768354231"
     variation       1439
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148296454"
     variation       1440
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746838511"
     variation       1448
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250732506"
     variation       1456
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535811836"
     variation       1464
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056674576"
     variation       1469
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940117697"
     variation       1474
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471409543"
     variation       1476
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909952131"
     variation       1479
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365192128"
     variation       1484
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185005464"
     variation       1487
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384956452"
     variation       1489
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406286894"
     variation       1493
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328400924"
     variation       1505
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392491788"
     variation       1510
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440481320"
     variation       1514
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984309373"
     variation       1522
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161858546"
     variation       1526
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309980368"
     variation       1527
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1337620674"
     variation       1532
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549310277"
     variation       1536
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926490825"
     variation       1538
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043445666"
     variation       1539
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775298629"
     variation       1540
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982346564"
     variation       1545..1549
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1467701731"
     variation       1545
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771909244"
     variation       1546
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9949903"
     variation       1554
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143260884"
     variation       1555
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009174264"
     variation       1556
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987894693"
     variation       1564
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180519146"
     variation       1579
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363703915"
     variation       1582
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966163578"
     variation       1586
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:562976462"
     variation       1592
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266362418"
     variation       1618
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224230727"
     variation       1624
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332276421"
     variation       1632
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032028035"
     variation       1633
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192902014"
     variation       1637
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888912090"
     variation       1645
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235067345"
     variation       1652
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052117641"
     variation       1653
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954329658"
     variation       1656
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333871807"
     variation       1658
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315672122"
     variation       1659
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219082291"
     variation       1664
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028531247"
     variation       1668
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337094069"
     variation       1669
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194688024"
     variation       1674
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997479964"
     variation       1677
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486245817"
     variation       1687
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229122097"
     variation       1691
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344907193"
     variation       1701
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897725485"
     variation       1702
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256087669"
     variation       1703
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388739058"
     variation       1710..1711
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1015984260"
     variation       1726
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:190266199"
     variation       1740
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171625089"
     variation       1741
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374956824"
     variation       1753
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555396114"
     variation       1757
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568041240"
     variation       1761
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184723102"
     variation       1764
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288088260"
     variation       1768
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004316397"
     variation       1780
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939982022"
     variation       1781
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414137822"
     variation       1783
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369605131"
     variation       1784
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048475547"
     variation       1788
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756301716"
     variation       1791
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056305684"
     variation       1796
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226242256"
     variation       1799
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002028089"
     variation       1805
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938163476"
     variation       1810
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756140608"
     variation       1812
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208184167"
     variation       1813
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278791363"
     variation       1814
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485645556"
     variation       1815
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200633271"
     variation       1817
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187435185"
     variation       1823
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:926851091"
     variation       1824
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426904302"
     variation       1836
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982681042"
     variation       1849
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946394176"
     variation       1860
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308388724"
     variation       1862
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204918038"
     variation       1863
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171904685"
     variation       1868
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463792342"
     variation       1875
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420262360"
     variation       1877
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290342457"
     variation       1878
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359619607"
     variation       1895
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534679556"
     variation       1901
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270598736"
     variation       1904
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142342394"
     variation       1908
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192580252"
     variation       1912
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1298167160"
     variation       1920
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052491541"
     variation       1922
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987785192"
     variation       1923
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529907187"
     variation       1927
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032057580"
     variation       1935
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987027897"
     variation       1940
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954194977"
     variation       1945
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204958758"
     variation       1946
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007222984"
     variation       1947
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235441443"
     variation       1954
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953244391"
     variation       1959
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041156"
     variation       1964
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455763916"
     variation       1969
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1030197765"
     variation       1976
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394560609"
     variation       1980..1985
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:558334880"
     variation       1981
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419540125"
     variation       1986
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343427718"
     variation       1989
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380337955"
     variation       1992
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452742405"
     variation       1994
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:974311410"
     variation       1996
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997742016"
     variation       2007
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897762614"
     variation       2013
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036661765"
     variation       2036
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321188911"
     variation       2038..2043
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1324571387"
     variation       2053
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041133"
     variation       2054
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376978709"
     variation       2055
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569137839"
     variation       2056
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309749556"
     variation       2060
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962907267"
     variation       2062
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781325359"
     variation       2069
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568041121"
     variation       2087
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041118"
     variation       2092
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535454543"
     variation       2097
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015595471"
     variation       2100
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469227979"
     variation       2107
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755167912"
     variation       2118
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004226020"
     variation       2120
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550498436"
     variation       2123
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048424116"
     variation       2126
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938111264"
     variation       2127
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905013591"
     variation       2129
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043550033"
     variation       2134
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186656934"
     variation       2135
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747541538"
     variation       2136..2154
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaacaaacaaacaaa"
                     /replace="aaacaaacaaacaaacaaa"
                     /replace="aaacaaacaaacaaacaaacaaa"
                     /db_xref="dbSNP:758782312"
     variation       2137
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1010830954"
     variation       2138
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419781436"
     variation       2142
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372175882"
     variation       2147
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190513348"
     variation       2148
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1354794188"
     variation       2151
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892344608"
     variation       2152..2155
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:1568041088"
     variation       2152
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295968570"
     variation       2153..2160
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aagt"
                     /replace="aagtaagt"
                     /db_xref="dbSNP:890237023"
     variation       2157
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:926687893"
     variation       2160
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337387343"
     variation       2161
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1272742462"
     variation       2165
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564957882"
     variation       2166
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206672544"
     variation       2171
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277046223"
     variation       2178
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540357202"
     variation       2193
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:914172105"
     variation       2196
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182234364"
     variation       2198
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948650"
     variation       2200
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542615586"
     variation       2214..2217
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1367184308"
     variation       2221
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298038644"
     variation       2222
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:924987477"
     variation       2227
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041063"
     variation       2228
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372145638"
     variation       2232
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766722670"
     variation       2233
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758924603"
     variation       2234
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167620003"
     variation       2239
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35247708"
     variation       2240
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336045576"
     variation       2243
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314013843"
     variation       2249
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975956881"
     variation       2250..2251
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1414563779"
     variation       2250
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960971746"
     variation       2252
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1362844670"
     variation       2258..2267
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaat"
                     /replace="aaaataaaat"
                     /db_xref="dbSNP:1165831619"
     variation       2258
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216568314"
     variation       2260..2264
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:538649655"
     variation       2267
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1395114485"
     variation       2269
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431249990"
     variation       2275
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980865113"
     variation       2277
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568041030"
ORIGIN      
ggtgaaataaacagccatgttgctcacacaaagcctgtttggtggtctcttcacacggacgctcatgaaatttggtgatgtgactcggatagggggacctcccttgggagatcagtaccctgtcctcctgctctttgctccgtgagaaagatccacctacaacctcaggtccttagaccaaccagcccaagaaacatctcaccaatttcaaatccagaccccactggaaatcggactgtccaactcacctgacagccactcccacagccgctggaactctggcccaaggctctctgactccttcccagatcttcttggcttagcggctgaagactgacgctgcccgatcgcctcggaagccccctagaccatcacggacgccgagcttcgggtaactctcacagtggaaggctggagtgcagtggtacaatcatggcacactgcagcctcaacctcatgggctcagagagggggttttgccatgtttcccaggctggtctcgaactcctgggctcaagtgatccgcccagctcagcctcccaaagtgctaggattacaagcatgagccactgcacccagccaaaagcccaaaatggtctcaggaatgggatcagcaggtctcagggttgtactctcctggatctctcaccagccacctcaaaccagctgccatagcctgtccacttccactccaatcttctcttccttcatcacctcccttgcacaccctgataacctcgaaagagaactcttcccaaggctctgttccaaacacatcgccactctgcttagaaccttcaatgactcctcatggcctaggaggtttctctcccatctggatccagctgacgttcccagcaccttctcctgactcctgtcttttcttgaaccagttctgcccaacaaggaggaaagggctgacagagtgaaagtcccagggcatgtgggaatgtgactcttttcactttaaattctatgactggaaagttttgggcagagttggacatgtgcacttagcttccagaagacagaatccttttaaaagagtcagagaaaacactggcttcctgccatgacatgagatacagacaggagagttgggaagctttttaaagatggcactatgactacaatcacagaaactctccatgaggaagtaaaagaaagcacctgcaacactccagctatgcagaccactctgtaatgggctcagatctggacaggtgtgtggaaaggtgggtcaacaggtcaggcgtcacagacttggaacattcatggtggaaaagaaaaagccccaaagaagagacttcaggataaatgagaaaatactcaagacagcaaaagtctcttttagaaatgttggagaaagaacacttaatgtcaggagttactgttgattgatggccttactgtgtagcaggtgagaaacccattgttcagttccctaaagtcaccctattctcccaatcatcctatggagggggaaccatgatggttatccccatcttataaataaagcaacagaggcttagaaggacgaactctttttctcaaggttacccagatcattttgcagaagtccctagatttgaatcatgctcttgctttgaggttaaagacacaggggaagtcgaactccttatctcctatatcctgaatagggaaaaccaaacattgtcaagaggagaggaagcctgagagttggcatgaatcagagtgctgggcagtctggagtcttccccactgagttgatgatggaacagtagagtggggcctgagccccgttagggcatgagctgctgaatgattcatgtgaacaccatgcacatgggagtgaggttttgagcagtgtgccacaggagcctaccctcaggccccaccataaaatgtagggccagtcctacattttatcaatgacttgcgtgaacacagaaaatgtggatacaaccaaaaggtaacaatccaattaaaaaatggacaaaaaacttgaataaacatttctcaaaagaagatatacaaatgatcaaaaagcatatgaaaaaatgctcaacatcgctaattgtaagagaaatgcaaatcaaaactataatgagataccaccttatattgattaggaagactgctataaaaatagtaaacaaacaaacaaacaaagtaagtcttggggaggatgcagagaaattaaaatttttgtgcactgttagtgggaatgtaaaatggtgcagctgttacgggaaacggtatgacagttcctcaaaaaataaaatgtagaaacagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]