GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:29:11, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_147212                630 bp    RNA     linear   PRI 12-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 237
            (LINC00237), long non-coding RNA.
ACCESSION   NR_147212
VERSION     NR_147212.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 630)
  AUTHORS   Vu PY, Toutain J, Cappellen D, Delrue MA, Daoud H, El Moneim AA,
            Barat P, Montaubin O, Bonnet F, Dai ZQ, Philippe C, Tran CT,
            Rooryck C, Arveiler B, Saura R, Briault S, Lacombe D and Taine L.
  TITLE     A homozygous balanced reciprocal translocation suggests LINC00237
            as a candidate gene for MOMO (macrosomia, obesity, macrocephaly,
            and ocular abnormalities) syndrome
  JOURNAL   Am. J. Med. Genet. A 158A (11), 2849-2856 (2012)
   PUBMED   23034868
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA272070.1 and AL121759.25.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA2157437
                              [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-130               DA272070.1         1-130
            131-139             DA272070.1         132-140
            140-518             DA272070.1         142-520
            519-519             AL121759.25        61667-61667         c
            520-630             DA272070.1         522-632
FEATURES             Location/Qualifiers
     source          1..630
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20p11.23"
     gene            1..630
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /note="long intergenic non-protein coding RNA 237"
                     /db_xref="GeneID:105372556"
                     /db_xref="HGNC:HGNC:38166"
                     /db_xref="MIM:614992"
     ncRNA           1..630
                     /ncRNA_class="lncRNA"
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /product="long intergenic non-protein coding RNA 237"
                     /db_xref="GeneID:105372556"
                     /db_xref="HGNC:HGNC:38166"
                     /db_xref="MIM:614992"
     exon            1..88
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185793517"
     variation       5
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140813687"
     variation       12
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576107221"
     variation       14
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1410284939"
     variation       15
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1398982868"
     variation       17
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318503260"
     variation       20
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1387789872"
     variation       21
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752819022"
     variation       25..29
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1017286695"
     variation       25
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901716829"
     variation       28
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338451696"
     variation       29
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338415578"
     variation       34
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1036322410"
     variation       36
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375313471"
     variation       43
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324880544"
     variation       47
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206045932"
     variation       50..65
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="ggcgaggcttggcgag"
                     /replace="ggcgaggcttggcgaggcttggcgag"
                     /db_xref="dbSNP:1182838133"
     variation       51
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363113759"
     variation       53
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765482557"
     variation       57
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322364718"
     variation       63
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442154745"
     variation       67
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372258634"
     variation       71
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007626496"
     variation       76
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044890552"
     exon            89..203
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /inference="alignment:Splign:2.1.0"
     variation       95
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:903335194"
     variation       100
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141359498"
     variation       106
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944961129"
     variation       107
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975876749"
     variation       113
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354685622"
     variation       114
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314722348"
     variation       120
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207820980"
     variation       131
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266436029"
     variation       136
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779861811"
     variation       137
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384482376"
     variation       150
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555402633"
     variation       154
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6137259"
     variation       155
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369243561"
     variation       157
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746227632"
     variation       158
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161771301"
     variation       164
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365373671"
     variation       166
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401068783"
     variation       173
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354660919"
     variation       176
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339167024"
     variation       188
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381157260"
     variation       189
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312858067"
     exon            204..630
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /inference="alignment:Splign:2.1.0"
     variation       206
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279945866"
     variation       208
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375319153"
     variation       209
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221969270"
     variation       212
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306279035"
     variation       215
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1227868282"
     variation       226
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353056648"
     variation       230
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188999919"
     variation       231
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211698644"
     variation       235
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366222220"
     variation       238
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055091879"
     variation       239
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141757633"
     variation       240
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379039149"
     variation       251
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6137256"
     variation       252
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175976577"
     variation       254
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936288212"
     variation       256
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043444914"
     variation       259
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:572763248"
     variation       273
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945555019"
     variation       275
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1175007428"
     variation       279
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903167691"
     variation       285
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041776201"
     variation       288
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371055894"
     variation       306
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356054823"
     variation       311
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439823072"
     variation       316
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297475830"
     variation       321
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371683735"
     variation       322
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168934653"
     variation       334
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:562855244"
     variation       340
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305698269"
     variation       341
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6137255"
     variation       344
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573409143"
     variation       352
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556769831"
     variation       353
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162043278"
     variation       357
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238058977"
     variation       360..362
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1469321894"
     variation       384
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196108278"
     variation       386
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952038906"
     variation       388
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114098784"
     variation       392
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256761191"
     variation       394
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6137254"
     variation       398
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77848954"
     variation       399
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961530408"
     variation       411
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6137253"
     variation       415
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330458026"
     variation       416
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539362970"
     variation       425
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442976897"
     variation       430
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896395065"
     variation       432
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1055014547"
     variation       433
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148475460"
     variation       438
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567125391"
     variation       446
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435865644"
     variation       459..474
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="aa"
                     /replace="aaatagttcacgtaaa"
                     /db_xref="dbSNP:1257797216"
     variation       464
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270926257"
     variation       469
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341775069"
     variation       470
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213125162"
     variation       478
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205640614"
     variation       481
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335966672"
     variation       486
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216089664"
     variation       487
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6137252"
     variation       491
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1193277213"
     variation       496
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253338366"
     variation       498
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903495911"
     variation       502
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474210820"
     variation       511
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169575888"
     variation       515
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043880082"
     variation       516
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462872471"
     variation       520
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321253971"
     variation       527
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530309715"
     variation       537
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1389931651"
     variation       542
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369665392"
     variation       545
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892661022"
     variation       550
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1328326484"
     variation       551
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349189556"
     variation       559
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567808890"
     variation       560
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356484870"
     variation       564..568
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1568883832"
     variation       567
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040520075"
     variation       568
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550779027"
     variation       570
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271744893"
     variation       571
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944995999"
     variation       578
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206293540"
     variation       579
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371999416"
     variation       581
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:910813663"
     variation       585
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023310406"
     variation       586
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012014270"
     variation       589
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894615449"
     variation       594
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033208350"
     variation       595
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000849408"
     variation       600
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476027384"
     variation       604
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572809796"
     variation       618
                     /gene="LINC00237"
                     /gene_synonym="NCRNA00237"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1185572646"
ORIGIN      
aaccggactgggctgcgcgcggagccccctcttcccgtgcacagtgcggggcgaggcttggcgagcggtgggtctgcgccttcccaagaagagactggggcagcatgaatgtgctggaagattagaggctgctgatgctgaaggaaggagaaacgaggaggaagtgtccctgtggacaagtcatctcccttcatttaagccagggaaggctgggaggtatgaatttgaagctggacacgttgctgctccccttaaagtttggattattttactaaagaagaagagaacaggtactgtgtaattaattggcaggaggagtttgctgccataaacacttgatgtgtgaatccacgctagttccctagcttctaagcctcagtttactcatctgtcacctgggaaaaaatatttgctcgttcctcactattatatcaggaatgaattgtgaagataaaatgaaatagttcacgtaaagtgcccattatagttctgggcacataaatgttaagaaatggtaatttaagaattaaggcatgaaaatatgttcagctttactagagactgggggaatgcaaactaaaatgccaacaagatgtaatttttctttcctttccaaatgacaaaaattaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]