GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:07:21, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_146895               1176 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 1724
            (LINC01724), long non-coding RNA.
ACCESSION   NR_146895
VERSION     NR_146895.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL592144.5.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1163658.541076.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1968968
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-213               AL592144.5         135501-135713       c
            214-333             AL592144.5         110167-110286       c
            334-516             AL592144.5         107995-108177       c
            517-1176            AL592144.5         91878-92537         c
FEATURES             Location/Qualifiers
     source          1..1176
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q31.3"
     gene            1..1176
                     /gene="LINC01724"
                     /note="long intergenic non-protein coding RNA 1724"
                     /db_xref="GeneID:105371673"
                     /db_xref="HGNC:HGNC:52512"
     ncRNA           1..1176
                     /ncRNA_class="lncRNA"
                     /gene="LINC01724"
                     /product="long intergenic non-protein coding RNA 1724"
                     /db_xref="GeneID:105371673"
                     /db_xref="HGNC:HGNC:52512"
     exon            1..213
                     /gene="LINC01724"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886701810"
     variation       10
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1224888557"
     variation       14
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335142691"
     variation       15
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269663675"
     variation       16
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471207646"
     variation       22
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563641797"
     variation       23..29
                     /gene="LINC01724"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1407497828"
     variation       23
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049193012"
     variation       29
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1196969846"
     variation       30
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470680321"
     variation       31
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410234623"
     variation       34
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930808647"
     variation       36
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751108420"
     variation       37
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158038496"
     variation       40
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402739563"
     variation       41
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766253061"
     variation       43
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975120357"
     variation       44
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942479238"
     variation       45
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912207670"
     variation       63
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277538384"
     variation       64
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542256469"
     variation       65
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361561356"
     variation       70
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762889837"
     variation       73
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444242741"
     variation       74
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906126123"
     variation       78
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045990423"
     variation       86
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777425431"
     variation       90
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181604071"
     variation       91
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461682474"
     variation       94
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283523169"
     variation       108
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114388699"
     variation       109
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020624457"
     variation       121
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260942697"
     variation       122
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422142039"
     variation       129
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169136302"
     variation       139
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396837930"
     variation       140..148
                     /gene="LINC01724"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:1326648049"
     variation       140
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559822239"
     variation       141
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990123544"
     variation       155
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384667564"
     variation       156
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957423628"
     variation       157
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034212098"
     variation       162
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541609214"
     variation       163
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907304049"
     variation       169
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375626212"
     variation       172..177
                     /gene="LINC01724"
                     /replace="tg"
                     /replace="tgaatg"
                     /db_xref="dbSNP:1340371063"
     variation       172
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1005297622"
     variation       177
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253130835"
     variation       181
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769642891"
     variation       186
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049772716"
     variation       187..195
                     /gene="LINC01724"
                     /replace="tgtg"
                     /replace="tgtgatgtg"
                     /db_xref="dbSNP:1462888527"
     variation       191
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559114343"
     variation       196
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10922020"
     variation       200
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900662543"
     variation       203
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454943722"
     variation       206
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543468333"
     exon            214..333
                     /gene="LINC01724"
                     /inference="alignment:Splign:2.1.0"
     variation       219
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019937550"
     variation       234
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907925346"
     variation       239
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335772951"
     variation       247
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:984848222"
     variation       253
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441050581"
     variation       255
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952164258"
     variation       257
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228732038"
     variation       263
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213096424"
     variation       267
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200400461"
     variation       268
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1028933630"
     variation       270
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974800491"
     variation       273
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181132479"
     variation       277
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231439520"
     variation       280
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777721192"
     variation       283
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203200417"
     variation       286
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019212440"
     variation       287
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352514770"
     variation       288
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000065233"
     variation       293
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772283299"
     variation       297
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261253781"
     variation       298
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460350429"
     variation       299
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1173394207"
     variation       301
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232537311"
     variation       306
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1408915662"
     variation       308
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902692872"
     variation       312
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756357189"
     variation       313
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143994558"
     variation       317
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:900341418"
     variation       324..330
                     /gene="LINC01724"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1296690803"
     variation       324
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1022506669"
     variation       328
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1040218308"
     exon            334..516
                     /gene="LINC01724"
                     /inference="alignment:Splign:2.1.0"
     variation       340
                     /gene="LINC01724"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1182617117"
     variation       344
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473277743"
     variation       354
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1411240897"
     variation       355
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471531051"
     variation       364
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372689349"
     variation       372
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016532729"
     variation       373
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002177325"
     variation       375
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12740444"
     variation       390
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1388829291"
     variation       392
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046433425"
     variation       395
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9633352"
     variation       396
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350420596"
     variation       397
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227040665"
     variation       398
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:887391775"
     variation       399
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1321842821"
     variation       402
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243407889"
     variation       404..406
                     /gene="LINC01724"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1291459264"
     variation       407
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896245997"
     variation       408
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205618150"
     variation       414
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250724944"
     variation       415
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047191442"
     variation       417
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189283882"
     variation       418
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1228358670"
     variation       421
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377486963"
     variation       422
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931497889"
     variation       423
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114415111"
     variation       424
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183568170"
     variation       427..429
                     /gene="LINC01724"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1256744154"
     variation       432
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530393333"
     variation       439
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925170569"
     variation       440
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226665609"
     variation       446
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383620133"
     variation       447
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431796501"
     variation       450
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868508383"
     variation       451
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:537047248"
     variation       456
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169643655"
     variation       457
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562968053"
     variation       461
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780167339"
     variation       462
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440896973"
     variation       463
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910205958"
     variation       467
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:910546392"
     variation       471
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987176736"
     variation       473
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542086751"
     variation       474
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954800642"
     variation       486
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325657929"
     variation       489
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030843796"
     variation       497
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405990852"
     variation       502
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396075508"
     variation       508
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377671058"
     exon            517..1176
                     /gene="LINC01724"
                     /inference="alignment:Splign:2.1.0"
     variation       525
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1242513315"
     variation       536
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:951050229"
     variation       543
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:571811954"
     variation       545
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027937576"
     variation       552
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170370345"
     variation       553..559
                     /gene="LINC01724"
                     /replace="ac"
                     /replace="actgtac"
                     /db_xref="dbSNP:1352947023"
     variation       557
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410548502"
     variation       559
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993403311"
     variation       571
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:897124346"
     variation       575
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:995398138"
     variation       578
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1016028040"
     variation       580
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342924735"
     variation       584
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900719921"
     variation       592
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303013139"
     variation       593
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362110647"
     variation       617..620
                     /gene="LINC01724"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1005594842"
     variation       621
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270499806"
     variation       628
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325221856"
     variation       642
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17688176"
     variation       645
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006603196"
     variation       648
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459760845"
     variation       651
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890753102"
     variation       660
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044538652"
     variation       661..671
                     /gene="LINC01724"
                     /replace="t"
                     /replace="tggaaagtaat"
                     /db_xref="dbSNP:1052085511"
     variation       675
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242620390"
     variation       678
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1475822481"
     variation       679
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758486679"
     variation       680
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:945957602"
     variation       681
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:891693036"
     variation       685
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75290883"
     variation       686
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471096073"
     variation       687
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177336628"
     variation       695
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934928040"
     variation       698
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:924263422"
     variation       704
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978844285"
     variation       708
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309736681"
     variation       710
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429479560"
     variation       719
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429885923"
     variation       722
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393903259"
     variation       724
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769001569"
     variation       729
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223757499"
     variation       735
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947109238"
     variation       743
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75961713"
     variation       748
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570534336"
     variation       754
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980147060"
     variation       757
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427713958"
     variation       758
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030132955"
     variation       766
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261130844"
     variation       769
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481423486"
     variation       773
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200486723"
     variation       774
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1428851152"
     variation       779
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558002422"
     variation       784
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479682684"
     variation       785
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192196098"
     variation       799
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950113889"
     variation       804
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386074237"
     variation       810
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12084738"
     variation       811
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983846960"
     variation       816
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242147408"
     variation       823
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950774407"
     variation       824
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866002776"
     variation       841
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343221706"
     variation       843
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:973716466"
     variation       845
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279654248"
     variation       846
                     /gene="LINC01724"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1349599387"
     variation       852
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222019362"
     variation       855
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208296948"
     variation       856
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964816580"
     variation       860
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223273141"
     variation       861
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314220988"
     variation       863
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017731531"
     variation       864
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015561020"
     variation       874
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77876610"
     variation       875
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184206311"
     variation       881
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955138908"
     variation       882
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223037478"
     variation       883
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1348371337"
     variation       888
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527442829"
     variation       893
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75895874"
     variation       898
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764410642"
     variation       899
                     /gene="LINC01724"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1387625426"
     variation       903
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424792319"
     variation       904
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290160804"
     variation       905
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:891498329"
     variation       906
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1410314420"
     variation       909
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1374322940"
     variation       910
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544639512"
     variation       912
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1300509350"
     variation       913
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005963410"
     variation       914
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467120974"
     variation       915
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054771979"
     variation       925
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392775877"
     variation       930
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577582366"
     variation       941
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335005274"
     variation       942
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418914472"
     variation       943
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562417065"
     variation       949
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544129677"
     variation       958
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291172962"
     variation       960
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1044265996"
     variation       962
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1197790618"
     variation       967
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473170335"
     variation       968
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950082504"
     variation       972
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177129185"
     variation       985
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895965288"
     variation       988
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11806727"
     variation       1007
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141667329"
     variation       1013
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773949457"
     variation       1015..1019
                     /gene="LINC01724"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1395281105"
     variation       1016
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574705536"
     variation       1018
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463055525"
     variation       1020
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168206307"
     variation       1030
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770572242"
     variation       1034
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920616738"
     variation       1040..1043
                     /gene="LINC01724"
                     /replace="t"
                     /replace="tgtt"
                     /db_xref="dbSNP:1558002356"
     variation       1043
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338480213"
     variation       1044
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383207050"
     variation       1047
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451830940"
     variation       1050
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312760940"
     variation       1051
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1338836169"
     variation       1053
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043351667"
     variation       1068
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1252150954"
     variation       1070
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215270477"
     variation       1072
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196936884"
     variation       1073
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265386358"
     variation       1075
                     /gene="LINC01724"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:973587053"
     variation       1076
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964951240"
     variation       1077
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533992305"
     variation       1078
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531085272"
     variation       1083
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193246003"
     variation       1094
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553182408"
     variation       1095..1096
                     /gene="LINC01724"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:552867320"
     variation       1100
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148011575"
     variation       1101
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406562301"
     variation       1106
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538625692"
     variation       1120
                     /gene="LINC01724"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563870230"
     variation       1123
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384047937"
     variation       1136
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985813484"
     variation       1141
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933088493"
     variation       1144..1145
                     /gene="LINC01724"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1379240808"
     variation       1156
                     /gene="LINC01724"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287950951"
     variation       1166
                     /gene="LINC01724"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:954924615"
     variation       1167
                     /gene="LINC01724"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1029824006"
     variation       1175
                     /gene="LINC01724"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:16839352"
ORIGIN      
ctgatgggtaagaggcctgggcaagaagatctaacagtgcgtcgagatgaaataaatgttgggaaataactagccagtttatgctacaagatacatgtctttataattgcatttatgatttgtgatttccttttacatcaagaagaagtcagaaaggattacgtatgaaattgaatgggagaaaattgtgatgtgtcaagtagaacagattagacaatgtgaaaatactttcacttcaaccccatgaagattacatagaagaaaatgccagatgaagttccttattgtttctcattcacagaatttatttccactaagttattaaaaaaatgggcaaaagaaagtggaacttcaactgttccttaggacaatacggacttgtgtttttgaagaagcaaagtggaaatgattaggcagcagggactctttgcagaaaaacgtaaggagcaaagaaaaatttctcagaaaaggagatttgaagcacaattgtcatcagttcacagaagaattttgaagttctgtttccagaggcctctctctgcctgcccagagactgtacatcttcagagatgagcaaaactctgcactctgcaaaatcagcaccctctgtctaatcaaaagttaacttggcccaggttttagtttctctgtaagttttgttggaaagtaatataataaatcttattacaagatacagctgattatgtatacattatgtctttggagaaatttgcattttaagaggaaggtcaaggatgccttaattacaaacattgcatttttggttatttaaatagtatctgggaaaacggtgaagatatataggaagttaagaaagatacctgtatctaccacgtgtgaaagattatctcagtaaatagaattggctacatattcatctattataataataccaaaaaagaagatatatatcttcaaagcgtcacaatttttgtagtcagcaaaatgaatggcaaagataatgagagaataaagatacaaaaatgagtatttaaaaatagaattccaatgggaaaactgttaattttaaaaattatatgtaaagatgaggttgctgttaagcattttacaccaatagagatatcaattggaatattttatgtgaagaaaagaaataatgacttaactttgtcaataaagaaagcatctacttgt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]