GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:28:52, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_146630                813 bp    RNA     linear   PRI 12-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 1980
            (LINC01980), long non-coding RNA.
ACCESSION   NR_146630 XR_937027 XR_940668
VERSION     NR_146630.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC098973.2.
            On or before Apr 13, 2017 this sequence version replaced
            XR_940668.1, XR_937027.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AW173098.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148874
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-324               AC098973.2         132111-132434       c
            325-411             AC098973.2         127172-127258       c
            412-510             AC098973.2         105274-105372       c
            511-574             AC098973.2         81258-81321         c
            575-813             AC098973.2         69697-69935         c
FEATURES             Location/Qualifiers
     source          1..813
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p24.1"
     gene            1..813
                     /gene="LINC01980"
                     /note="long intergenic non-protein coding RNA 1980"
                     /db_xref="GeneID:105377007"
                     /db_xref="HGNC:HGNC:52808"
     ncRNA           1..813
                     /ncRNA_class="lncRNA"
                     /gene="LINC01980"
                     /product="long intergenic non-protein coding RNA 1980"
                     /db_xref="GeneID:105377007"
                     /db_xref="HGNC:HGNC:52808"
     exon            1..324
                     /gene="LINC01980"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558544756"
     variation       3
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302053878"
     variation       5
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266583236"
     variation       6
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938243789"
     variation       10
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486293656"
     variation       11
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559945378"
     variation       12
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262737091"
     variation       13
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328582888"
     variation       14
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241834623"
     variation       21
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258780158"
     variation       22
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142146815"
     variation       24
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:917546683"
     variation       27
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210167413"
     variation       31
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301068944"
     variation       33
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1269395415"
     variation       43
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535363136"
     variation       48
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449733526"
     variation       50
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949164939"
     variation       55
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1385168749"
     variation       56
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2371117"
     variation       64
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252438234"
     variation       65
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902251598"
     variation       69
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575133526"
     variation       75
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450917051"
     variation       76
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934505691"
     variation       80
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053107834"
     variation       84
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427152286"
     variation       86
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895884668"
     variation       88
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428909356"
     variation       89
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001135362"
     variation       90
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014789728"
     variation       95
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750219091"
     variation       96
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905863934"
     variation       98
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:995066639"
     variation       108
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1206094950"
     variation       115
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151279151"
     variation       119..122
                     /gene="LINC01980"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1255947197"
     variation       137
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453512637"
     variation       139
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228541913"
     variation       144
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328569383"
     variation       145..149
                     /gene="LINC01980"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1164126758"
     variation       152
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297272749"
     variation       154
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996060691"
     variation       163
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363799124"
     variation       166
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028331180"
     variation       168
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955598753"
     variation       169
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393596350"
     variation       172
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008222230"
     variation       173
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016124767"
     variation       174
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171928944"
     variation       176
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1462298437"
     variation       178
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324687397"
     variation       179
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961468507"
     variation       180
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563834753"
     variation       182
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449132297"
     variation       183
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376948097"
     variation       190
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755229803"
     variation       195
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577420657"
     variation       196
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781245099"
     variation       199
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920063352"
     variation       200
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546292044"
     variation       204
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184343803"
     variation       209
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35439826"
     variation       218
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920899965"
     variation       233
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953849561"
     variation       235
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1559945428"
     variation       259
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:978617988"
     variation       260..266
                     /gene="LINC01980"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1237423002"
     variation       267
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528451331"
     variation       272
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:547714056"
     variation       273
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781435253"
     variation       278
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934600669"
     variation       298
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918174161"
     variation       303
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756175965"
     variation       304
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332660973"
     variation       310
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212968748"
     variation       316
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:917111316"
     variation       319
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1166446207"
     variation       324
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559945439"
     exon            325..411
                     /gene="LINC01980"
                     /inference="alignment:Splign:2.1.0"
     variation       326
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459140355"
     variation       332
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366161983"
     variation       336..340
                     /gene="LINC01980"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1163465533"
     variation       343
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357421193"
     variation       355
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176538052"
     variation       364
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465453959"
     variation       366
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186070059"
     variation       370
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267820999"
     variation       375
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211822704"
     variation       376
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376739792"
     variation       379..380
                     /gene="LINC01980"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:772095822"
     variation       392
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:553431743"
     variation       396
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032985242"
     variation       397
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356461599"
     variation       403
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6808561"
     variation       405
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996902119"
     variation       408
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331989342"
     exon            412..510
                     /gene="LINC01980"
                     /inference="alignment:Splign:2.1.0"
     variation       420
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477881220"
     variation       421
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462426664"
     variation       423
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428190604"
     variation       425
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193855769"
     variation       431
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478517536"
     variation       433
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868625779"
     variation       434
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260493213"
     variation       441
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191823777"
     variation       444
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181385542"
     variation       450
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967780804"
     variation       452
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182860962"
     variation       457
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:981500944"
     variation       467
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198541802"
     variation       468
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322498130"
     variation       470
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236469299"
     variation       483
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187256085"
     variation       491
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11922228"
     variation       492
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958966105"
     variation       500
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055980084"
     variation       509
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448809982"
     exon            511..574
                     /gene="LINC01980"
                     /inference="alignment:Splign:2.1.0"
     variation       512
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1559956547"
     variation       515
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987111190"
     variation       516..517
                     /gene="LINC01980"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1559956551"
     variation       518
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769413047"
     variation       520
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188302486"
     variation       539
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:532237975"
     variation       540
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1249403187"
     variation       545
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200299188"
     variation       555
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552254287"
     variation       558
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318965927"
     variation       566
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423985001"
     variation       573
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565677040"
     variation       574
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62622826"
     exon            575..813
                     /gene="LINC01980"
                     /inference="alignment:Splign:2.1.0"
     variation       575
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937362366"
     variation       581
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145596841"
     variation       590
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299891500"
     variation       592
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888065054"
     variation       595
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904350331"
     variation       597
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402666468"
     variation       599
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365138265"
     variation       602
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316281471"
     variation       628
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000100110"
     variation       629
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454927552"
     variation       630
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183900306"
     variation       633
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302163632"
     variation       637
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527384682"
     variation       643
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413538916"
     variation       646
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396647292"
     variation       651
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547473804"
     variation       655
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9968142"
     variation       663
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389497410"
     variation       677
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277322804"
     variation       678
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473693047"
     variation       684
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559958872"
     variation       685
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536973210"
     variation       690
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235506439"
     variation       706
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349841376"
     variation       709
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2304723"
     variation       715
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755660670"
     variation       723
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203133916"
     variation       724
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994294215"
     variation       732
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293141048"
     variation       734
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1230517222"
     variation       735
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2887957"
     variation       738
                     /gene="LINC01980"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983537255"
     variation       741
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357033643"
     variation       743
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:955180228"
     variation       745
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538689050"
     variation       746
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538685771"
     variation       747
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558992319"
     variation       758
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957295389"
     variation       761
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164194407"
     variation       763
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334006850"
     variation       767
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411406163"
     variation       771
                     /gene="LINC01980"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181099379"
     variation       780
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989967511"
     variation       782
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973661783"
     variation       783..785
                     /gene="LINC01980"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1180198817"
     variation       787
                     /gene="LINC01980"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927492091"
     variation       793
                     /gene="LINC01980"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1231296420"
     variation       796
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1292563795"
     variation       800
                     /gene="LINC01980"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937010179"
     variation       807
                     /gene="LINC01980"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992521387"
ORIGIN      
gcgccgggatgcgctctcctcttctcatttgccaatttattgcagatccctcctcaaaaaagttttgggactaactcagccccatggagatcaaggtgaattagaaaaacaacaaaacaaaacaagattcattttaacatctcatttttctatctccaactttccctcccctcctcccaccccaggaagaaaagactacgtttgtttctggtgatacattcattgtaggtgggtgggtgacttctagaagaggaaaatcaagaagatttggagaaggagtcttggaagctctggtgaagttttccaaaactgggaaggacagagtctgctcagcctgtgttagtggagaagagggaaggaaactggctggaggccgctggacccacagaggacaatagacaatctcctgctgatgcccactggatccaaagagagaaactctatagaattatgatctaggtttgactgactcctggcaagaagccctacccgccagccaatttggatgaggtcacaggggtcatccatctttccttctatgtgactggtttgctcttgcatatcatgttttccgctcttatgctccagatccatcatgagaagaacatgccctggattcctgctatccctttagccatggctccaaaattaacacacacaaggaagacctgaggtcaatccacagcctggattcaagtcacctaatacataggagaatcagagctacccagccacactcaatctacgttaactgaacctcagctgacctgcagatttatgagtatgagaataaaggcttgttaatgtatatca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]