GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:37:41, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_146574                529 bp    RNA     linear   PRI 12-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 2136
            (LINC02136), long non-coding RNA.
ACCESSION   NR_146574 XR_001733696 XR_001752335
VERSION     NR_146574.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 529)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     PREDICTED REFSEQ: This record has not been reviewed and the
            function is unknown. The reference sequence was derived from
            DA211558.1.
            On or before Apr 8, 2017 this sequence version replaced
            XR_001752335.1, XR_001733696.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA211558.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01820697 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-529               DA211558.1         1-529
FEATURES             Location/Qualifiers
     source          1..529
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16q22.2"
     gene            1..529
                     /gene="LINC02136"
                     /note="long intergenic non-protein coding RNA 2136"
                     /db_xref="GeneID:105371333"
                     /db_xref="HGNC:HGNC:52995"
     ncRNA           1..529
                     /ncRNA_class="lncRNA"
                     /gene="LINC02136"
                     /product="long intergenic non-protein coding RNA 2136"
                     /db_xref="GeneID:105371333"
                     /db_xref="HGNC:HGNC:52995"
     exon            1..304
                     /gene="LINC02136"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527917128"
     variation       3
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909497721"
     variation       5
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348837210"
     variation       10
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438058883"
     variation       13
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327512596"
     variation       20
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371188546"
     variation       21
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382037928"
     variation       22
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566741310"
     variation       24
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1454734692"
     variation       25
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11644434"
     variation       26
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1156711975"
     variation       31
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268738559"
     variation       32
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009940050"
     variation       35
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956642104"
     variation       37
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289785081"
     variation       38
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:927725374"
     variation       39
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530216187"
     variation       40
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879450429"
     variation       42
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215575730"
     variation       43
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253873871"
     variation       44
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74499657"
     variation       45
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192238854"
     variation       46
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971945785"
     variation       48
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023144075"
     variation       49
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753503837"
     variation       52
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562700647"
     variation       56
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904512060"
     variation       58
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459415536"
     variation       59
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166412609"
     variation       61
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442247446"
     variation       63
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957683148"
     variation       65
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315749757"
     variation       67
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431913203"
     variation       68
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763778908"
     variation       71
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996905086"
     variation       83
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032968001"
     variation       84
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901337674"
     variation       85
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241945271"
     variation       86
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143579975"
     variation       88
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203656624"
     variation       89
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462416040"
     variation       92
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746298997"
     variation       95
                     /gene="LINC02136"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1193547699"
     variation       96
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029677256"
     variation       97
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531503565"
     variation       99
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215593019"
     variation       103
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256751090"
     variation       106
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474154762"
     variation       108
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447882405"
     variation       113
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417999326"
     variation       127
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998294111"
     variation       143
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9930764"
     variation       144
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039540038"
     variation       151
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358841835"
     variation       154
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:941270839"
     variation       156
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354139426"
     variation       157
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533982315"
     variation       163
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048113222"
     variation       164..167
                     /gene="LINC02136"
                     /replace="cccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1262716149"
     variation       165
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:888397301"
     variation       167
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236961317"
     variation       168
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546003698"
     variation       172
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926248083"
     variation       173
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771103910"
     variation       176
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:980519664"
     variation       177
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970501657"
     variation       179
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213019551"
     variation       186
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046750062"
     variation       188
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929607100"
     variation       191
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178967566"
     variation       192
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429791493"
     variation       194
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470281291"
     variation       195
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172603330"
     variation       196
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345500445"
     variation       197
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138032761"
     variation       202
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422616177"
     variation       204
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981826186"
     variation       206
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150313829"
     variation       209..223
                     /gene="LINC02136"
                     /replace="gggacccgggacccg"
                     /replace="gggacccgggacccgggacccg"
                     /db_xref="dbSNP:1163710831"
     variation       211
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389773826"
     variation       214
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1567554396"
     variation       216
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916062289"
     variation       217
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032240746"
     variation       223
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991705748"
     variation       224
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301518581"
     variation       225
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345537620"
     variation       227
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957844455"
     variation       228
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212680837"
     variation       230
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033248594"
     variation       242
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:968696415"
     variation       244
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280963681"
     variation       248
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374115085"
     variation       249
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028238484"
     variation       253
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:977661678"
     variation       254
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997377506"
     variation       257
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192698374"
     variation       266
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967321408"
     variation       268
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901248737"
     variation       269
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041637545"
     variation       274
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185506196"
     variation       275
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1174609983"
     variation       277
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004365424"
     variation       283..284
                     /gene="LINC02136"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:779747787"
     variation       283
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460958716"
     variation       286
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029626368"
     variation       290
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324151505"
     variation       292
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998638485"
     variation       299
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048690072"
     variation       302
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931514578"
     exon            305..435
                     /gene="LINC02136"
                     /inference="alignment:Splign:2.1.0"
     variation       305
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:981202412"
     variation       308
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:993410704"
     variation       317
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162042259"
     variation       320
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368060535"
     variation       330
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406053334"
     variation       334
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1288753175"
     variation       338
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946754232"
     variation       339
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915280407"
     variation       340
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143936282"
     variation       344
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382296057"
     variation       345
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988254006"
     variation       355
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289290297"
     variation       362
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027972871"
     variation       364..366
                     /gene="LINC02136"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:996501656"
     variation       365
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222251305"
     variation       367
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484610940"
     variation       368
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900930672"
     variation       369
                     /gene="LINC02136"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1040764910"
     variation       372
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1443602767"
     variation       381..383
                     /gene="LINC02136"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1188979198"
     variation       382
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256858321"
     variation       384..387
                     /gene="LINC02136"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:939851542"
     variation       391
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280550304"
     variation       394
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543534422"
     variation       405
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567552334"
     variation       413
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343877634"
     variation       414
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956489526"
     variation       418
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455466892"
     variation       420
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289502750"
     variation       433
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382360996"
     variation       434
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450770749"
     exon            436..529
                     /gene="LINC02136"
                     /inference="alignment:Splign:2.1.0"
     variation       436
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933026342"
     variation       441
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545505819"
     variation       466
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402114369"
     variation       467
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226190976"
     variation       474..491
                     /gene="LINC02136"
                     /replace="cag"
                     /replace="caggaaggggcctggcag"
                     /db_xref="dbSNP:1234739984"
     variation       477
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577911287"
     variation       483
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302568957"
     variation       484
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1328899742"
     variation       496
                     /gene="LINC02136"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937789649"
     variation       505
                     /gene="LINC02136"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:971815473"
     variation       506
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1196305959"
     variation       508
                     /gene="LINC02136"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760729622"
     variation       512
                     /gene="LINC02136"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775534297"
     variation       517
                     /gene="LINC02136"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458492716"
     variation       523
                     /gene="LINC02136"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1213689792"
     variation       527
                     /gene="LINC02136"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251659935"
ORIGIN      
gtaagaaaatgcctgcagccccttgcactcgcggagtcatctacgcaaggtcgggctctgcaggcagcagcttctggtctcaccccgggcttgtgcgcacacctggggacatgtgggaaggtcgctcttgcggccactgagcggcctggcctcagggaacgagccccgcgccgggaagaaagctgcctgccgggagcgcagcctattggggacccgggacccgagccaccgcggctcaccaagaggcggtggggccctgcggtgcgtgtgggacgccgggcaggcagactctgagcacggccaggaggcaagaagagattgaagggaaatctcaaggggctccagagactactacgatggtgcaaagtcacagaagccctgggaaaagcaggtagaatggagttgccatgacattgagcctcacctagatgccagttccagatattggcagactgctggcctcctgaggagcacaggaaggggcctggcagactggtgatcctggttggagatgaagaggggctgatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]