GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:22:42, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_146456               1080 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 2446
            (LINC02446), transcript variant 2, long non-coding RNA.
ACCESSION   NR_146456
VERSION     NR_146456.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC068775.52.
            
            Transcript Variant: This variant (2) differs in the 3' end compared
            to variant 1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1163655.58686.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2155628, SAMEA2159764
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-138               AC068775.52        137564-137701
            139-215             AC068775.52        156423-156499
            216-1080            AC068775.52        159009-159873
FEATURES             Location/Qualifiers
     source          1..1080
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13.2"
     gene            1..1080
                     /gene="LINC02446"
                     /note="long intergenic non-protein coding RNA 2446"
                     /db_xref="GeneID:101060038"
                     /db_xref="HGNC:HGNC:53378"
     ncRNA           1..1080
                     /ncRNA_class="lncRNA"
                     /gene="LINC02446"
                     /product="long intergenic non-protein coding RNA 2446,
                     transcript variant 2"
                     /db_xref="GeneID:101060038"
                     /db_xref="HGNC:HGNC:53378"
     exon            1..138
                     /gene="LINC02446"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487738683"
     variation       2
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022717895"
     variation       11
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546163935"
     variation       14
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205898389"
     variation       17
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138159046"
     variation       18
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184682972"
     variation       20
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033842594"
     variation       29
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141617836"
     variation       30
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304935309"
     variation       42
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346790019"
     variation       43
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1026588924"
     variation       47
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950971154"
     variation       54..62
                     /gene="LINC02446"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:202150189"
     variation       54
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992548639"
     variation       60
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:917020320"
     variation       63
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414698544"
     variation       64
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1289068642"
     variation       67
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352355764"
     variation       69..77
                     /gene="LINC02446"
                     /replace="tttgt"
                     /replace="tttgtttgt"
                     /db_xref="dbSNP:1399467768"
     variation       75
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929599010"
     variation       87
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866275744"
     variation       91..92
                     /gene="LINC02446"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1168399964"
     variation       91
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943533447"
     variation       93
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565537729"
     variation       94
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982430956"
     variation       101..104
                     /gene="LINC02446"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1175674901"
     variation       113
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190181194"
     variation       114
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377653105"
     variation       120
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933347231"
     variation       122..124
                     /gene="LINC02446"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1312966467"
     variation       122
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212036044"
     variation       124
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206098966"
     variation       128
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325119899"
     exon            139..215
                     /gene="LINC02446"
                     /inference="alignment:Splign:2.1.0"
     variation       139
                     /gene="LINC02446"
                     /replace="g"
                     /replace="gtatatg"
                     /db_xref="dbSNP:1475647248"
     variation       142..150
                     /gene="LINC02446"
                     /replace="agaa"
                     /replace="agaagagaa"
                     /db_xref="dbSNP:1437032672"
     variation       143
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376889243"
     variation       151
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1173920220"
     variation       160
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169402058"
     variation       166
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779600028"
     variation       167
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178835451"
     variation       177
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527643618"
     variation       184
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057297938"
     variation       185
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470482122"
     variation       194
                     /gene="LINC02446"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1417079480"
     variation       206
                     /gene="LINC02446"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1232294391"
     variation       208
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409315590"
     exon            216..1080
                     /gene="LINC02446"
                     /inference="alignment:Splign:2.1.0"
     variation       230
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211580205"
     variation       251
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1242676367"
     variation       260
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944128328"
     variation       265
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259500496"
     variation       268
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:561528426"
     variation       269
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036586606"
     variation       271
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899339382"
     variation       274
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042360852"
     variation       275
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289662736"
     variation       276
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470967615"
     variation       277
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230787942"
     variation       278
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530644541"
     variation       288
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923959945"
     variation       289..291
                     /gene="LINC02446"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:953523589"
     variation       309
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778327196"
     variation       312
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428999586"
     variation       318
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378929942"
     variation       320
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304509348"
     variation       328
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009384428"
     variation       334..335
                     /gene="LINC02446"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1364647046"
     variation       362
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018926361"
     variation       368
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1431158061"
     variation       375
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576082438"
     variation       388
                     /gene="LINC02446"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1174874959"
     variation       391
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053949314"
     variation       392
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:895437446"
     variation       406
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988704511"
     variation       411
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490245340"
     variation       421
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267083924"
     variation       424
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749682935"
     variation       427
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047007139"
     variation       445
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906919186"
     variation       451
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333607167"
     variation       453
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1272872862"
     variation       456
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003049977"
     variation       460..465
                     /gene="LINC02446"
                     /replace="gaa"
                     /replace="gaagaa"
                     /db_xref="dbSNP:1444716164"
     variation       463
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:550617391"
     variation       464
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352776611"
     variation       466
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76872865"
     variation       468
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961014717"
     variation       469
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2125096"
     variation       476
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281005783"
     variation       478..482
                     /gene="LINC02446"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:202068470"
     variation       480
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026900156"
     variation       485..491
                     /gene="LINC02446"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:940303796"
     variation       485
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1408124788"
     variation       490
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404345342"
     variation       513
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439038786"
     variation       516..524
                     /gene="LINC02446"
                     /replace="tatatat"
                     /replace="tatatatat"
                     /db_xref="dbSNP:1036618697"
     variation       521
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237170412"
     variation       524
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953945077"
     variation       528
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139875901"
     variation       534..535
                     /gene="LINC02446"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34674348"
     variation       535
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379672317"
     variation       542
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930885139"
     variation       548
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232385775"
     variation       551
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019878084"
     variation       553
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172496308"
     variation       563
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74897207"
     variation       575
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375496998"
     variation       589
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329607514"
     variation       595..596
                     /gene="LINC02446"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35781159"
     variation       596
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:555332632"
     variation       603
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565542460"
     variation       604
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321897309"
     variation       612
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009002792"
     variation       615
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441854806"
     variation       624
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280902690"
     variation       629
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531900520"
     variation       630
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305376966"
     variation       638
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329073404"
     variation       640
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:568644227"
     variation       642
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775547317"
     variation       645
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1009560542"
     variation       646
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337333634"
     variation       650
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:564416972"
     variation       653
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180987193"
     variation       656
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1196177730"
     variation       658
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161481048"
     variation       659
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401501335"
     variation       660
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:948314942"
     variation       663
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371260584"
     variation       666
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1468650534"
     variation       682
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906714057"
     variation       683
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958754755"
     variation       687
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244251664"
     variation       688..693
                     /gene="LINC02446"
                     /replace="aca"
                     /replace="acaaca"
                     /db_xref="dbSNP:1183524992"
     variation       690
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:940894601"
     variation       697
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992585410"
     variation       698
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217034251"
     variation       702
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036770465"
     variation       703
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2125095"
     variation       718
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198836290"
     variation       727
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143762446"
     variation       728
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572934854"
     variation       731
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026659179"
     variation       735
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920246051"
     variation       738
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550498725"
     variation       747
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565542487"
     variation       750
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889305180"
     variation       759
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755594435"
     variation       770
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290382520"
     variation       780
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431265306"
     variation       790
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344782704"
     variation       792
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462170393"
     variation       796
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295501553"
     variation       800..801
                     /gene="LINC02446"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1388382180"
     variation       805
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1426558119"
     variation       811
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385960228"
     variation       813
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541697880"
     variation       816
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443327282"
     variation       818
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296262423"
     variation       830
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569999434"
     variation       834
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892582124"
     variation       837
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009591746"
     variation       853
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213215879"
     variation       855
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022274930"
     variation       867
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762839392"
     variation       870
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216674555"
     variation       871
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146849577"
     variation       874
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357164017"
     variation       885
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297668545"
     variation       894
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000130007"
     variation       897
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544081340"
     variation       920
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958567677"
     variation       926
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1406984183"
     variation       938
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148994290"
     variation       943
                     /gene="LINC02446"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958119141"
     variation       949..953
                     /gene="LINC02446"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1024137221"
     variation       949
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171766770"
     variation       953
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989408578"
     variation       957..963
                     /gene="LINC02446"
                     /replace="tta"
                     /replace="ttagtta"
                     /db_xref="dbSNP:1428217745"
     variation       968
                     /gene="LINC02446"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1417829029"
     variation       975
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766028807"
     variation       982
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209649628"
     variation       989
                     /gene="LINC02446"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10772319"
     variation       993
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:60400937"
     variation       1002
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1269216366"
     variation       1004
                     /gene="LINC02446"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185450400"
     variation       1011
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767171962"
     variation       1014
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143816606"
     variation       1015
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205155888"
     variation       1022
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306908795"
     variation       1027
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920294466"
     variation       1030
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189811458"
     variation       1044
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366906388"
     variation       1046
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752229331"
     variation       1051
                     /gene="LINC02446"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1282904865"
     variation       1052
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550130818"
     variation       1053
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931063612"
     variation       1057
                     /gene="LINC02446"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299182388"
     variation       1066
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461907521"
     variation       1073
                     /gene="LINC02446"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289257608"
     variation       1077
                     /gene="LINC02446"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1178994164"
ORIGIN      
gcttggcccactctcactctgtggagtgtacatttgtttccataaatctgtgctttttttttcattgttttgtttgtgcatttcatccaattgtttgttcaaaatgccaagaatctggacaccctccaccagtaacaggcaagaagagaatagaggcaaagcaagccactccagaagtcctctagccagctttgtctttagtttgatggccagagaggaaatccaagccaaaagctccttttggagacaagaatattctgacagcacctcctacgatgtgacagagtcaaagaagaaaatatacaagagaactctgctatagaaaattacaaattcaaaccatgggaaaatggggaatagaaaaattatctctttagacagagaaaagattataaatactgaaaattgtcatttctataaatgtcattgctcttctgttttacattgtgtaaatatttggaagaaaatggcacaattttctttcaaaaaaagggaaacattcaaaatatttaaattatatatattatatatgtaacatgatcagcaagtctggaaacataacgaagttttatagtattgatttattcctatcactctgagatatggtgacattacatgatatgttcaacgtgttgttcctcattagcaatgtgttatgcataatggggaccaacatgggacattaatacaacatttctatcagtgcctgcacatgcttctgtgatacgttgcctccaatgatttttgtctctaattttcagaatataaacctgctccattagcattttctggaagaagcaatcaaatgggttaatctgtgaaagtaaatgttatctatatttcccaacattatggccatcctgtattaacgtatattatgtatattctgaactgctccataattggaatagtcattccttatcaataatttacttgatatcatggatatgtgtcttttagttaatgatccctttgccaactagcctagtttataggcagtgactatatcatactcattttgaattcccaatacttaccacagcttcctatacatggtagttgtttaataaataattcttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]