GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:04:27, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_145798                147 bp    RNA     linear   PRI 25-MAY-2018
DEFINITION  Homo sapiens small nucleolar RNA, H/ACA box 116 (SNORA116), small
            nucleolar RNA.
ACCESSION   NR_145798
VERSION     NR_145798.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 147)
  AUTHORS   Jorjani H, Kehr S, Jedlinski DJ, Gumienny R, Hertel J, Stadler PF,
            Zavolan M and Gruber AR.
  TITLE     An updated human snoRNAome
  JOURNAL   Nucleic Acids Res. 44 (11), 5068-5082 (2016)
   PUBMED   27174936
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL360169.17.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data. The genomic coordinates used for the transcript record were
            based on predicted data.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-147               AL360169.17        153916-154062       c
FEATURES             Location/Qualifiers
     source          1..147
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q25.3"
     gene            1..147
                     /gene="SNORA116"
                     /note="small nucleolar RNA, H/ACA box 116"
                     /db_xref="GeneID:109623462"
                     /db_xref="HGNC:HGNC:51854"
     ncRNA           1..147
                     /ncRNA_class="snoRNA"
                     /gene="SNORA116"
                     /product="small nucleolar RNA, H/ACA box 116"
                     /db_xref="GeneID:109623462"
                     /db_xref="HGNC:HGNC:51854"
     exon            1..147
                     /gene="SNORA116"
                     /inference="alignment:Splign:2.1.0"
     variation       8
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298581778"
     variation       11
                     /gene="SNORA116"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484529843"
     variation       14
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005298872"
     variation       21
                     /gene="SNORA116"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1205596455"
     variation       23
                     /gene="SNORA116"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349929002"
     variation       27..28
                     /gene="SNORA116"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35108892"
     variation       37
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978241827"
     variation       48
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401244977"
     variation       51
                     /gene="SNORA116"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016660307"
     variation       55
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1395612092"
     variation       56
                     /gene="SNORA116"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963832484"
     variation       57
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339029049"
     variation       62
                     /gene="SNORA116"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549882917"
     variation       78
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570164318"
     variation       79
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766730932"
     variation       83
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989882613"
     variation       103
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157017668"
     variation       106
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538782322"
     variation       108
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942598159"
     variation       117
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164431405"
     variation       121
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474361596"
     variation       137
                     /gene="SNORA116"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374560479"
     variation       142
                     /gene="SNORA116"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193681046"
     variation       145
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988055792"
     variation       147
                     /gene="SNORA116"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913728035"
ORIGIN      
cttttctcagtggtgcaagaagattaagccacattctggctttagagaggcatttctgagagagatgaaggacacttcgttccccagccccaacctaagcatgtgactgtactcaccttgtcagatgctgttggaacctggctgaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]