GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:25:58, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_144387               1200 bp    RNA     linear   PRI 05-DEC-2018
DEFINITION  Homo sapiens fibronectin leucine rich transmembrane protein 2
            (FLRT2), transcript variant 7, non-coding RNA.
ACCESSION   NR_144387
VERSION     NR_144387.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1200)
  AUTHORS   Bae H, Kim B, Lee H, Lee S, Kang HS and Kim SJ.
  TITLE     Epigenetically regulated Fibronectin leucine rich transmembrane
            protein 2 (FLRT2) shows tumor suppressor activity in breast cancer
            cells
  JOURNAL   Sci Rep 7 (1), 272 (2017)
   PUBMED   28325946
  REMARK    GeneRIF: Taken together, these results provide insights into the
            role of FLRT2 as a novel tumor suppressor in the breast, which is
            inactivated by hypermethylation during tumor development.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1200)
  AUTHORS   Jackson VA, Mehmood S, Chavent M, Roversi P, Carrasquero M, Del
            Toro D, Seyit-Bremer G, Ranaivoson FM, Comoletti D, Sansom MS,
            Robinson CV, Klein R and Seiradake E.
  TITLE     Super-complexes of adhesion GPCRs and neural guidance receptors
  JOURNAL   Nat Commun 7, 11184 (2016)
   PUBMED   27091502
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1200)
  AUTHORS   Wu Y, Davison J, Qu X, Morrissey C, Storer B, Brown L, Vessella R,
            Nelson P and Fang M.
  TITLE     Methylation profiling identified novel differentially methylated
            markers including OPCML and FLRT2 in prostate cancer
  JOURNAL   Epigenetics 11 (4), 247-258 (2016)
   PUBMED   26890304
  REMARK    GeneRIF: OPCML and FLRT2 were further validated in an independent
            cohort consisting of 20 low-Gleason and 33 high-Gleason tissues. We
            then compared patients with biochemical recurrence (n=70) vs. those
            without (n=86) in a third cohort, and they showed no difference in
            methylation at these DMR loci
REFERENCE   4  (bases 1 to 1200)
  AUTHORS   Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray
            TA, Kay JN and Wojtowicz WM.
  TITLE     An extracellular biochemical screen reveals that FLRTs and Unc5s
            mediate neuronal subtype recognition in the retina
  JOURNAL   Elife 4, e08149 (2015)
   PUBMED   26633812
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1200)
  AUTHORS   Jackson VA, del Toro D, Carrasquero M, Roversi P, Harlos K, Klein R
            and Seiradake E.
  TITLE     Structural basis of latrophilin-FLRT interaction
  JOURNAL   Structure 23 (4), 774-781 (2015)
   PUBMED   25728924
REFERENCE   6  (bases 1 to 1200)
  AUTHORS   Kuo JC, Han X, Hsiao CT, Yates JR 3rd and Waterman CM.
  TITLE     Analysis of the myosin-II-responsive focal adhesion proteome
            reveals a role for beta-Pix in negative regulation of focal
            adhesion maturation
  JOURNAL   Nat. Cell Biol. 13 (4), 383-393 (2011)
   PUBMED   21423176
REFERENCE   7  (bases 1 to 1200)
  AUTHORS   Wheeler HE, Metter EJ, Tanaka T, Absher D, Higgins J, Zahn JM,
            Wilhelmy J, Davis RW, Singleton A, Myers RM, Ferrucci L and Kim SK.
  TITLE     Sequential use of transcriptional profiling, expression
            quantitative trait mapping, and gene association implicates MMP20
            in human kidney aging
  JOURNAL   PLoS Genet. 5 (10), e1000685 (2009)
   PUBMED   19834535
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   8  (bases 1 to 1200)
  AUTHORS   Haines BP, Wheldon LM, Summerbell D, Heath JK and Rigby PW.
  TITLE     Regulated expression of FLRT genes implies a functional role in the
            regulation of FGF signalling during mouse development
  JOURNAL   Dev. Biol. 297 (1), 14-25 (2006)
   PUBMED   16872596
REFERENCE   9  (bases 1 to 1200)
  AUTHORS   Zhang Z and Henzel WJ.
  TITLE     Signal peptide prediction based on analysis of experimentally
            verified cleavage sites
  JOURNAL   Protein Sci. 13 (10), 2819-2824 (2004)
   PUBMED   15340161
REFERENCE   10 (bases 1 to 1200)
  AUTHORS   Lacy SE, Bonnemann CG, Buzney EA and Kunkel LM.
  TITLE     Identification of FLRT1, FLRT2, and FLRT3: a novel family of
            transmembrane leucine-rich repeat proteins
  JOURNAL   Genomics 62 (3), 417-426 (1999)
   PUBMED   10644439
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL049775.2 and BX119446.1.
            
            Summary: This gene encodes a member of the fibronectin leucine rich
            transmembrane (FLRT) family of cell adhesion molecules, which
            regulate early embryonic vascular and neural development. The
            encoded type I transmembrane protein has an extracellular region
            consisting of an N-terminal leucine-rich repeat domain and a type 3
            fibronectin domain, followed by a transmembrane domain and a short
            C-terminal cytoplasmic tail domain. It functions as both a
            homophilic cell adhesion molecule and a heterophilic chemorepellent
            through its interaction with members of the uncoordinated-5
            receptor family. Proteolytic removal of the extracellular region
            controls the migration of neurons in the developing cortex.
            Alternative splicing results in multiple transcript variants.
            [provided by RefSeq, Sep 2016].
            
            Transcript Variant: This variant (7) uses an alternate exon
            structure compared to variant 1 and lacks the coding region found
            in variant 1. This variant is represented as non-coding because it
            lacks the entire coding region found in variant 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: CF128778.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-510               AL049775.2         95728-96237
            511-566             AL049775.2         96870-96925
            567-677             AL049775.2         118436-118546
            678-705             AL049775.2         126893-126920
            706-1200            BX119446.1         1-495
FEATURES             Location/Qualifiers
     source          1..1200
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q31.3"
     gene            1..1200
                     /gene="FLRT2"
                     /note="fibronectin leucine rich transmembrane protein 2"
                     /db_xref="GeneID:23768"
                     /db_xref="HGNC:HGNC:3761"
                     /db_xref="MIM:604807"
     misc_RNA        1..1200
                     /gene="FLRT2"
                     /product="fibronectin leucine rich transmembrane protein
                     2, transcript variant 7"
                     /db_xref="GeneID:23768"
                     /db_xref="HGNC:HGNC:3761"
                     /db_xref="MIM:604807"
     exon            1..510
                     /gene="FLRT2"
                     /inference="alignment:Splign:2.1.0"
     variation       5
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:865905635"
     variation       17
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035517044"
     variation       25
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148199097"
     variation       28
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956900509"
     variation       34
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988678845"
     variation       35
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280860762"
     variation       41
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141126403"
     variation       44
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023323588"
     variation       53
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339322844"
     variation       55
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331665608"
     variation       56
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416069028"
     variation       64
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541308471"
     variation       67
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385704716"
     variation       72
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298511253"
     variation       75
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969388882"
     variation       79
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546594133"
     variation       81
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413905499"
     variation       85
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179105797"
     variation       86
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470646666"
     variation       88
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236933530"
     variation       91
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944260671"
     variation       93
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463041057"
     variation       95
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1039757181"
     variation       97
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921247747"
     variation       102
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207278092"
     variation       104
                     /gene="FLRT2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:931426296"
     variation       106
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540218551"
     variation       111
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048501268"
     variation       115..123
                     /gene="FLRT2"
                     /replace="tagtt"
                     /replace="tagttagtt"
                     /db_xref="dbSNP:1275246044"
     variation       118
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762607071"
     variation       122
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775726523"
     variation       123
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:887157230"
     variation       127
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281900910"
     variation       128
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974461203"
     variation       131
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319728529"
     variation       138
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1432821843"
     variation       144
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346690866"
     variation       150..151
                     /gene="FLRT2"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1488906559"
     variation       153
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159598297"
     variation       155
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401484231"
     variation       158
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413420693"
     variation       162
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919965514"
     variation       168
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446455214"
     variation       170
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057339717"
     variation       179
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150485276"
     variation       181
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265282513"
     variation       186
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982837263"
     variation       189
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:912688720"
     variation       193
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450670428"
     variation       196
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944219944"
     variation       197
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566709351"
     variation       200
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:895761087"
     variation       207
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247721490"
     variation       215
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573586763"
     variation       216
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1182429349"
     variation       221
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039926925"
     variation       226
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411232560"
     variation       227
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566709372"
     variation       231
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364035282"
     variation       234
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455427007"
     variation       235
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435583532"
     variation       240
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796457612"
     variation       244..248
                     /gene="FLRT2"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:1394988750"
     variation       245
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022622846"
     variation       247
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301466591"
     variation       252
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426814507"
     variation       253
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543945882"
     variation       254
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168084849"
     variation       258
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448182839"
     variation       259
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422342907"
     variation       260
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187465545"
     variation       262
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947688646"
     variation       266
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457055010"
     variation       271
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042744587"
     variation       273
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:902887542"
     variation       274
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998571175"
     variation       276
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035442666"
     variation       280
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309184983"
     variation       289
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296128445"
     variation       294
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895627417"
     variation       298
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365164677"
     variation       301
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999781230"
     variation       303
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113033644"
     variation       304
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56105610"
     variation       305
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460588007"
     variation       309
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022820245"
     variation       310
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171664289"
     variation       311
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414419072"
     variation       315
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427586538"
     variation       322
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1350455864"
     variation       323
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988342472"
     variation       325
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963622059"
     variation       329
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295447985"
     variation       330
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322707560"
     variation       333
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531114003"
     variation       340
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546450205"
     variation       341
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026908377"
     variation       343
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263966815"
     variation       347
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:564768939"
     variation       351
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528825348"
     variation       362
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223954310"
     variation       371
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206022443"
     variation       372
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376621464"
     variation       383
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:912657780"
     variation       387
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931310231"
     variation       388
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414178422"
     variation       390
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751097239"
     variation       392
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423033197"
     variation       394
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965517807"
     variation       395
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984083142"
     variation       397
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547279808"
     variation       400
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470471181"
     variation       412
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355976787"
     variation       420
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975969774"
     variation       424
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754553949"
     variation       427
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895634398"
     variation       430
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250579776"
     variation       437
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948671605"
     variation       438
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:118107793"
     variation       452
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1244962100"
     variation       455
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904407174"
     variation       457
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328156236"
     variation       461
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561884493"
     variation       467
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529307953"
     variation       468..469
                     /gene="FLRT2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1318993624"
     variation       473
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380339426"
     variation       478
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395581317"
     variation       481
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339206104"
     variation       485
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031727861"
     variation       489
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388317923"
     variation       496
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287530347"
     variation       497
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947620442"
     variation       499
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009046187"
     variation       500
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163458319"
     variation       501
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776772455"
     variation       504
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924235174"
     variation       506
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310816648"
     variation       507
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934333959"
     exon            511..566
                     /gene="FLRT2"
                     /inference="alignment:Splign:2.1.0"
     variation       513
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1422054024"
     variation       514
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747169641"
     variation       522
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187518381"
     variation       523
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275458765"
     variation       528
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377079360"
     variation       529
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537191156"
     variation       534
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201139581"
     variation       535
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768830897"
     variation       536..554
                     /gene="FLRT2"
                     /replace="tggagagcatacgaggcgg"
                     /replace="tggagagcatacgaggcggtggagagcatacgaggcgg"
                     /db_xref="dbSNP:1490353833"
     variation       538..550
                     /gene="FLRT2"
                     /replace="gagagcatacgag"
                     /replace="gagagcatacgagagcatacgag"
                     /db_xref="dbSNP:1231833331"
     variation       540
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286335902"
     variation       541
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202305620"
     variation       542
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309238848"
     variation       544
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935961617"
     variation       546..562
                     /gene="FLRT2"
                     /replace="acgaggcggaatccgga"
                     /replace="acgaggcggaatccggacgaggcggaatccgga"
                     /db_xref="dbSNP:1207930316"
     variation       547
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265811968"
     variation       548
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187518764"
     variation       550
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199161318"
     variation       552..555
                     /gene="FLRT2"
                     /replace=""
                     /replace="cgga"
                     /db_xref="dbSNP:1297719417"
     variation       552
                     /gene="FLRT2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1245569653"
     variation       552
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913113979"
     variation       553
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978912257"
     variation       554..556
                     /gene="FLRT2"
                     /replace=""
                     /replace="gaa"
                     /db_xref="dbSNP:1566710161"
     variation       556
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469551709"
     variation       558
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146131114"
     variation       559
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776567449"
     variation       560..561
                     /gene="FLRT2"
                     /replace=""
                     /replace="gg"
                     /db_xref="dbSNP:1491582080"
     variation       560
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414911350"
     variation       561
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:555154149"
     variation       561
                     /gene="FLRT2"
                     /replace="g"
                     /replace="ggcgag"
                     /db_xref="dbSNP:1491181388"
     variation       562
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916862217"
     variation       563
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140120710"
     variation       564
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1005683094"
     variation       565
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562639400"
     exon            567..677
                     /gene="FLRT2"
                     /inference="alignment:Splign:2.1.0"
     variation       569
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435514259"
     variation       572
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178240518"
     variation       577
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:893617994"
     variation       579
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376485759"
     variation       580
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344208551"
     variation       589
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577906954"
     variation       595
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566723603"
     variation       600
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181165903"
     variation       612
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225052167"
     variation       613
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167425730"
     variation       614
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386093369"
     variation       618
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042326764"
     variation       619
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1284109137"
     variation       623
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441722854"
     variation       624
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756811734"
     variation       625
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330974060"
     variation       629
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392540007"
     variation       644
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983415413"
     variation       649
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1174735333"
     variation       660
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117266817"
     variation       661
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572320814"
     variation       667
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035711378"
     exon            678..777
                     /gene="FLRT2"
                     /inference="alignment:Splign:2.1.0"
     variation       689
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952479748"
     variation       693
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755589217"
     variation       697
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908367733"
     variation       701
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299066340"
     variation       702
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316786846"
     variation       730
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187873507"
     variation       733
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167075369"
     variation       743
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424468957"
     variation       746
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879456951"
     variation       747
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767246801"
     variation       748
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294014707"
     variation       753
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1185226191"
     variation       759
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193018774"
     variation       760
                     /gene="FLRT2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1264294890"
     variation       767
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199125474"
     variation       773
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040948130"
     exon            778..1187
                     /gene="FLRT2"
                     /inference="alignment:Splign:2.1.0"
     variation       781
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987218903"
     variation       783
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1169888477"
     variation       789
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018252140"
     variation       795
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321091764"
     variation       799
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387939130"
     variation       802
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770070687"
     variation       806
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964119982"
     variation       836
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777990680"
     variation       841
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974115504"
     variation       847
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425564082"
     variation       852
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749298971"
     variation       853
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377276003"
     variation       854
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196847725"
     variation       863
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770744618"
     variation       864
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054252875"
     variation       872
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:535414728"
     variation       873
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198524321"
     variation       875
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377261277"
     variation       876
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415338241"
     variation       877
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137873561"
     variation       906
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:539784298"
     variation       914
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010101157"
     variation       916
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272660114"
     variation       922
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020140923"
     variation       923
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928552403"
     variation       924
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270452644"
     variation       931
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938585564"
     variation       942
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907106316"
     variation       945
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894130240"
     variation       952..968
                     /gene="FLRT2"
                     /replace="aat"
                     /replace="aatgacctgggggaaat"
                     /db_xref="dbSNP:1352150121"
     variation       957
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329367242"
     variation       958
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413627510"
     variation       960..964
                     /gene="FLRT2"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1566729611"
     variation       960
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774306944"
     variation       962
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281864993"
     variation       964
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112458751"
     variation       970
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170985510"
     variation       974
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:575303911"
     variation       979
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947152323"
     variation       983
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:539937698"
     variation       997
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178075714"
     variation       1003
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002758519"
     variation       1004
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187574706"
     variation       1006
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441092249"
     variation       1009
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183004537"
     variation       1011..1014
                     /gene="FLRT2"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1000109268"
     variation       1011
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216469403"
     variation       1016
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276106897"
     variation       1018
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959402849"
     variation       1019
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212631264"
     variation       1029
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991308854"
     variation       1030
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1284765311"
     variation       1040
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558412946"
     variation       1049
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375444592"
     variation       1055..1057
                     /gene="FLRT2"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1280005989"
     variation       1057
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447040972"
     variation       1068
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189447924"
     variation       1071
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1475117434"
     variation       1080
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335901808"
     variation       1092
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436870871"
     variation       1095
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008461176"
     variation       1096
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158128526"
     variation       1099
                     /gene="FLRT2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866319884"
     variation       1111
                     /gene="FLRT2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1166171479"
     variation       1114
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963189164"
     variation       1119..1130
                     /gene="FLRT2"
                     /replace="tctacttatcta"
                     /replace="tctacttatctacttatcta"
                     /db_xref="dbSNP:561145817"
     variation       1124
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018720168"
     variation       1126
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964006488"
     variation       1127
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435214732"
     variation       1132
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972918389"
     variation       1133
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562004715"
     variation       1137..1140
                     /gene="FLRT2"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1485835171"
     variation       1144
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934199559"
     variation       1145
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261929846"
     variation       1146
                     /gene="FLRT2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1213837506"
     variation       1148
                     /gene="FLRT2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318146602"
     variation       1150
                     /gene="FLRT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573993910"
     variation       1154
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383776939"
     variation       1158
                     /gene="FLRT2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027030889"
     variation       1163..1170
                     /gene="FLRT2"
                     /replace="aataa"
                     /replace="aataataa"
                     /db_xref="dbSNP:1325433013"
     regulatory      1166..1171
                     /regulatory_class="polyA_signal_sequence"
                     /gene="FLRT2"
     variation       1178
                     /gene="FLRT2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294963248"
     variation       1186..1187
                     /gene="FLRT2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1356352378"
     polyA_site      1187
                     /gene="FLRT2"
     variation       1187
                     /gene="FLRT2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:987055995"
ORIGIN      
ccagcttctctagggagtgtcaggcgcacacagggttaagttagttccctccctggtaggagggagaggaggaggaggggaaaagcagcatactgtctcaggctgggtaccttgtagttagttgtacgttcgaaacctgtcgccgtcacttgcgcgtttggcattatccattgtcaccgcggaggaacgagcgctcgagatatcatcagtgcccgcaaatctccgcgccaaggcgctgagctactcctttccgaggtgcgcctctggtcctccgtccctggtgcccagcagcggcgaggcggcatctccgctcccgccgccgtgtccaccgagccctgggatcagggtggcagttctcaacgatgggcaggagggacctcggcggcgacccctaaaacaataccatgccccgggatccccgctgctgccgcgccagcgtcttccctttccacctccctgaccctgtcggattcggatgagcccattgcaaggagaagacgcagccgtcagagcgcctgcggaggtggcgaaggcttggagagcatacgaggcggaatccggatcgaacaggtaagacacggagacctttgggttgatggcaagatttggagggctgattatggcgcctttgatgtgaggaggtattcctgcaatccttccgagacacctaagctgcttttcagaagctatctcctgagcagtgtgtaattctctcctggctgtttgatggtaatgggagctgtacatgtatctggagagaggagaaccagcctggggactcaagatatattaaagactatgctcatggacatcaattctttcctgtcctttagggcagtattcaggccacacggttcaataacgggaaagaatgtcgtcacatgattgcatcatgttcttcaaaatgaaatctattgaacagtataaacaacaaagaacatcatttgtcagaatgacctgggggaaatagtccagtgaaactaagcaaagggaactttataccgtgagggaaaatcaatggattgtaacagaaccctgcaagaagagacatagctttcaagttccagagacctagaggtgactgagaagcaggatgtaccagaaactgggcttcttgttctacttatctagcgcccttttcacagtgttgtatatgtaaataaataataaagcagtgtgatttttaaaaaaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]