GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:03:52, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_134908                573 bp    RNA     linear   PRI 25-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 1841
            (LINC01841), long non-coding RNA.
ACCESSION   NR_134908
VERSION     NR_134908.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 573)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA691808.1 and AC008569.7.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA691808.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2153031, SAMEA2155371
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-185               DA691808.1         1-185
            186-186             AC008569.7         59974-59974         c
            187-270             DA691808.1         187-270
            271-271             AC008569.7         54933-54933         c
            272-547             DA691808.1         272-547
            548-555             AC008569.7         40085-40092         c
            556-573             DA691808.1         556-573
FEATURES             Location/Qualifiers
     source          1..573
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.12"
     gene            1..573
                     /gene="LINC01841"
                     /note="long intergenic non-protein coding RNA 1841"
                     /db_xref="GeneID:105372288"
                     /db_xref="HGNC:HGNC:52655"
     ncRNA           1..573
                     /ncRNA_class="lncRNA"
                     /gene="LINC01841"
                     /product="long intergenic non-protein coding RNA 1841"
                     /db_xref="GeneID:105372288"
                     /db_xref="HGNC:HGNC:52655"
     exon            1..119
                     /gene="LINC01841"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171324657"
     variation       7
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193311257"
     variation       11
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041205776"
     variation       12
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909147429"
     variation       21
                     /gene="LINC01841"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250032177"
     variation       24
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436825515"
     variation       29
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1311085292"
     variation       32
                     /gene="LINC01841"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1354930229"
     variation       38
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542646063"
     variation       41
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189096762"
     variation       45
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942965726"
     variation       46..53
                     /gene="LINC01841"
                     /replace="gaga"
                     /replace="gagagaga"
                     /db_xref="dbSNP:946540293"
     variation       57
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914686134"
     variation       61
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890005144"
     variation       73
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572364894"
     variation       76
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258909806"
     variation       77
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277507112"
     variation       78
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942772651"
     variation       79
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185979167"
     variation       80
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192282295"
     variation       83
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936721426"
     variation       90
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923943682"
     variation       94
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568298042"
     variation       96
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436769908"
     variation       98
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172045774"
     variation       99
                     /gene="LINC01841"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568298035"
     variation       102
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745691813"
     variation       103
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955631090"
     variation       105
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291133069"
     variation       109
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383519231"
     variation       113
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949460633"
     exon            120..243
                     /gene="LINC01841"
                     /inference="alignment:Splign:2.1.0"
     variation       120
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362578984"
     variation       126
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951356895"
     variation       129
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027296973"
     variation       137
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387456370"
     variation       139
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426214096"
     variation       141
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892825548"
     variation       148
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300867670"
     variation       159
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033089571"
     variation       160
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143975282"
     variation       161
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902900698"
     variation       162..163
                     /gene="LINC01841"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1330236316"
     variation       179
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042581684"
     variation       182
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428623426"
     variation       194..195
                     /gene="LINC01841"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1197422966"
     variation       199
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013740727"
     variation       206
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489212979"
     variation       213
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776686419"
     variation       220
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76216716"
     variation       225
                     /gene="LINC01841"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1243450261"
     variation       233
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768273741"
     variation       234
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481047245"
     variation       236
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:59220736"
     exon            244..355
                     /gene="LINC01841"
                     /inference="alignment:Splign:2.1.0"
     variation       244
                     /gene="LINC01841"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901563271"
     variation       248
                     /gene="LINC01841"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:886500886"
     variation       252
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041255127"
     variation       255
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563420986"
     variation       262
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:889946106"
     variation       269..271
                     /gene="LINC01841"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1296994707"
     variation       269
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433054428"
     variation       282
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541427793"
     variation       292
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1221440265"
     variation       303
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277054005"
     variation       306
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159021715"
     variation       311
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209744187"
     variation       327
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:936916867"
     variation       328
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271469509"
     variation       346
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899455876"
     exon            356..573
                     /gene="LINC01841"
                     /inference="alignment:Splign:2.1.0"
     variation       358
                     /gene="LINC01841"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1391346294"
     variation       360
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933604932"
     variation       369
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747018868"
     variation       380
                     /gene="LINC01841"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:918513594"
     variation       383
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373871093"
     variation       385
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:983487512"
     variation       391
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:952174112"
     variation       393
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:987133602"
     variation       397
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027557192"
     variation       398
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:796965971"
     variation       402
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166262667"
     variation       404
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:953048144"
     variation       406
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780436433"
     variation       409
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:569541221"
     variation       411
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1381128517"
     variation       415
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999915768"
     variation       416
                     /gene="LINC01841"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452372808"
     variation       420
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958777641"
     variation       421
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442102762"
     variation       424..427
                     /gene="LINC01841"
                     /replace="tcaa"
                     /replace="tcaatcaa"
                     /db_xref="dbSNP:747138780"
     variation       424
                     /gene="LINC01841"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1229122834"
     variation       425
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034355134"
     variation       429
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316739934"
     variation       430
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150235771"
     variation       431
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022438589"
     variation       433
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181092105"
     variation       439
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536388342"
     variation       445
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430559284"
     variation       448
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565696947"
     variation       450
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226177471"
     variation       451
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178589271"
     variation       452..458
                     /gene="LINC01841"
                     /replace="tg"
                     /replace="tgtgttg"
                     /db_xref="dbSNP:1361484829"
     variation       454
                     /gene="LINC01841"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404549467"
     variation       455..462
                     /gene="LINC01841"
                     /replace=""
                     /replace="gttggttc"
                     /db_xref="dbSNP:1465934698"
     variation       460..462
                     /gene="LINC01841"
                     /replace=""
                     /replace="ttc"
                     /db_xref="dbSNP:1315527467"
     variation       460
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892752788"
     variation       471
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778061920"
     variation       473
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338367518"
     variation       480
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330409934"
     variation       489
                     /gene="LINC01841"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383623202"
     variation       490
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020551270"
     variation       491..493
                     /gene="LINC01841"
                     /replace="ggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1223607934"
     variation       491
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056728246"
     variation       495
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758791769"
     variation       501
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321367581"
     variation       502
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753041328"
     variation       506
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569467579"
     variation       507
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045184492"
     variation       509
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930719205"
     variation       520
                     /gene="LINC01841"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765486056"
     variation       522
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1387599531"
     variation       529
                     /gene="LINC01841"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033584522"
     variation       530
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036225322"
     variation       532
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:889542238"
     variation       540
                     /gene="LINC01841"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940512836"
     variation       561
                     /gene="LINC01841"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472647216"
ORIGIN      
acgagcgggggtggggaagagaagagggcacagaggccagcggatgagagagacaccagggagcctgggatgcctgcccgaggctctggccacgcccatgccctgcctgtcccgctaagcacacagaggaaaggccatgtgaggacacagcaagaaggcggccatctgcaagccaagaagagagtcctcaccaggaaccaactctgctgacaccttgctgttggacttccagcctctataaatgttcacaagcacaccactgtttacacccatctagaaggcccctcccagctgacatctttctgcctacctttcaggaagacagacgaaactctctgccttcaggtggggcaagactgctgatggctggaacaggagcttggcacctccaccctgacccagacacaagcctgtctgtcccactcaaatcgagctggccagagactacaactgtgttggttcccaagacatagaaaagccagaagaggtcgggcgcagtggctcacgcctgtcagcactttgggaagccgaggcaggcagattacctaaggtcaagagttcaagaccaatctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]