GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:10:21, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_134614                758 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens uncharacterized LOC105374972 (LOC105374972),
            transcript variant 2, long non-coding RNA.
ACCESSION   NR_134614
VERSION     NR_134614.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 758)
  AUTHORS   Bonaldo MF, Lennon G and Soares MB.
  TITLE     Normalization and subtraction: two approaches to facilitate gene
            discovery
  JOURNAL   Genome Res. 6 (9), 791-806 (1996)
   PUBMED   8889548
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BX113657.1 and W93315.1.
            
            Transcript Variant: This variant (2) lacks an exon and contains two
            alternate 3' exons, resulting in a shorter transcript than variant
            1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX113657.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-405               BX113657.1         1-405
            406-665             BX113657.1         407-666
            666-758             W93315.1           3-95                c
FEATURES             Location/Qualifiers
     source          1..758
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6p22.3"
     gene            1..758
                     /gene="LOC105374972"
                     /note="uncharacterized LOC105374972"
                     /db_xref="GeneID:105374972"
     ncRNA           1..758
                     /ncRNA_class="lncRNA"
                     /gene="LOC105374972"
                     /product="uncharacterized LOC105374972, transcript variant
                     2"
                     /db_xref="GeneID:105374972"
     exon            1..204
                     /gene="LOC105374972"
                     /inference="alignment:Splign:2.1.0"
     variation       7
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419808445"
     variation       9..11
                     /gene="LOC105374972"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1458755505"
     variation       11
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006771050"
     variation       13..18
                     /gene="LOC105374972"
                     /replace="ac"
                     /replace="actaac"
                     /db_xref="dbSNP:1169003345"
     variation       18
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354288237"
     variation       23
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323807013"
     variation       38
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912065695"
     variation       40
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479085610"
     variation       44
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278341080"
     variation       55
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554809867"
     variation       69
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1050495851"
     variation       70
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424490572"
     variation       75
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288184637"
     variation       78
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889661748"
     variation       94
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:932087186"
     variation       97
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290829593"
     variation       100
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453152060"
     variation       104
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1269771510"
     variation       105..109
                     /gene="LOC105374972"
                     /replace="tactt"
                     /replace="tacttactt"
                     /db_xref="dbSNP:1237513312"
     variation       110
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16886808"
     variation       111
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891523197"
     variation       116
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114056107"
     variation       117
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:962089689"
     variation       118
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382928038"
     variation       151
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250522169"
     variation       161
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202438921"
     variation       163..183
                     /gene="LOC105374972"
                     /replace="cactttg"
                     /replace="cactttgtggaggtcactttg"
                     /db_xref="dbSNP:1327212959"
     variation       172
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319897067"
     variation       174
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907756883"
     variation       177
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992768567"
     variation       180
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142008555"
     variation       190
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959828208"
     variation       192
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448083526"
     variation       197
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312078192"
     exon            205..249
                     /gene="LOC105374972"
                     /inference="alignment:Splign:2.1.0"
     variation       205
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1310535233"
     variation       213
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210174284"
     variation       219
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915945734"
     variation       220
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572716282"
     variation       221
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:16886726"
     variation       223
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1262165399"
     exon            250..758
                     /gene="LOC105374972"
                     /inference="alignment:Splign:2.1.0"
     variation       255
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9466423"
     variation       256
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034836455"
     variation       257
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276260775"
     variation       259
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311447454"
     variation       264
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255631669"
     variation       265
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210380614"
     variation       271
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:980472549"
     variation       272..285
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="gtgccagcagcccg"
                     /db_xref="dbSNP:761103849"
     variation       274..296
                     /gene="LOC105374972"
                     /replace="gccagcagcc"
                     /replace="gccagcagcccgcgccagcagcc"
                     /replace="gccagcagcccgcgccagcagcccgcgccagcagcc"
                     /db_xref="dbSNP:57020587"
     variation       275..286
                     /gene="LOC105374972"
                     /replace=""
                     /replace="ccagcagcccgc"
                     /db_xref="dbSNP:1322068754"
     variation       276
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486995216"
     variation       283
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953209834"
     variation       284
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367803638"
     variation       287
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554135642"
     variation       288..306
                     /gene="LOC105374972"
                     /replace="ccagca"
                     /replace="ccagcagcctgcaccagca"
                     /db_xref="dbSNP:1414301919"
     variation       288..289
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1285808262"
     variation       298
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423503693"
     variation       300
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1484500749"
     variation       302
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373142976"
     variation       310
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177028174"
     variation       312
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296656145"
     variation       313
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561845228"
     variation       317
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377521441"
     variation       328
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417893626"
     variation       329
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444660057"
     variation       331..336
                     /gene="LOC105374972"
                     /replace="cag"
                     /replace="cagcag"
                     /db_xref="dbSNP:1273073012"
     variation       333
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432792042"
     variation       337
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401042118"
     variation       342
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1366603979"
     variation       344
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234294167"
     variation       346
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:997294267"
     variation       347
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280251798"
     variation       350
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022369046"
     variation       354
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215190352"
     variation       355
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374411990"
     variation       356
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892127205"
     variation       360
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218525163"
     variation       362
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031887465"
     variation       363
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999201725"
     variation       365
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999120652"
     variation       376
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438076716"
     variation       387
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561845195"
     variation       388
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158331359"
     variation       394
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111381479"
     variation       403
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402564828"
     variation       405
                     /gene="LOC105374972"
                     /replace="t"
                     /replace="tggact"
                     /db_xref="dbSNP:1427083420"
     variation       414
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769053238"
     variation       425
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948286065"
     variation       429
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1436851313"
     variation       433
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932715434"
     variation       434
                     /gene="LOC105374972"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1305375355"
     variation       440
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374464252"
     variation       446..455
                     /gene="LOC105374972"
                     /replace="ac"
                     /replace="actataaaac"
                     /db_xref="dbSNP:1355204846"
     variation       446
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330243853"
     variation       449
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899957909"
     variation       455
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038864891"
     variation       459
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226137202"
     variation       461..463
                     /gene="LOC105374972"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1222692394"
     variation       461
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9466422"
     variation       470
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908552451"
     variation       473
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175057878"
     variation       477
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982698262"
     variation       479
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939297507"
     variation       481..482
                     /gene="LOC105374972"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:773046660"
     variation       485
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561845170"
     variation       488
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381201961"
     variation       490
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749766955"
     variation       494
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927791430"
     variation       503
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962750797"
     variation       506
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980604758"
     variation       507
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969105795"
     variation       513
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:953261967"
     variation       515
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028864122"
     variation       517
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571333996"
     variation       518
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997355386"
     variation       523
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569758078"
     variation       528
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234678184"
     variation       529
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316646756"
     variation       532
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022003920"
     variation       534..538
                     /gene="LOC105374972"
                     /replace="tg"
                     /replace="tgttg"
                     /db_xref="dbSNP:1275643108"
     variation       534
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989641439"
     variation       535
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234433634"
     variation       540
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305319979"
     variation       542
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775924659"
     variation       544
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198436274"
     variation       545
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551505138"
     variation       546
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138737756"
     variation       548..549
                     /gene="LOC105374972"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:34611989"
     variation       562
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450498674"
     variation       563
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999089669"
     variation       566
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559849833"
     variation       568
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150261556"
     variation       569
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529286003"
     variation       575
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029834610"
     variation       576
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043357613"
     variation       582
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1156705391"
     variation       585
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398110567"
     variation       586
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561845142"
     variation       590
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393912528"
     variation       592
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333171384"
     variation       596
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:996979939"
     variation       597
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416142236"
     variation       607
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295598848"
     variation       609
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012482969"
     variation       611
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562454459"
     variation       615
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252239897"
     variation       619
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900007588"
     variation       620
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:10806960"
     variation       623
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:576638856"
     variation       627
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:939538962"
     variation       629..634
                     /gene="LOC105374972"
                     /replace=""
                     /replace="tagtct"
                     /db_xref="dbSNP:375140995"
     variation       635
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887098722"
     variation       638
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047083117"
     variation       644
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486973901"
     variation       645
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="cccc"
                     /db_xref="dbSNP:139331339"
     variation       645
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918717097"
     variation       656
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190195030"
     variation       658
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748559491"
     variation       660
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244458635"
     variation       664
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939261628"
     variation       671
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477460850"
     variation       679
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561845113"
     variation       682
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558075082"
     variation       688
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1374575820"
     variation       689
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561845109"
     variation       692
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464391172"
     variation       693
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374642596"
     variation       714
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187409434"
     variation       721
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577336317"
     variation       731
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295828413"
     variation       732
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17415785"
     variation       733
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291308636"
     variation       737
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567140210"
     variation       742
                     /gene="LOC105374972"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296971434"
     variation       743
                     /gene="LOC105374972"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947855810"
     variation       744
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985449248"
     variation       748
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10806959"
     variation       749
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213039175"
     variation       750
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283951729"
     variation       751
                     /gene="LOC105374972"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989220657"
ORIGIN      
ctctctgatctgactaacctctttcattctttgccctatgttatatggcttagaccaaagcctgagacatttaaccaatttataaatattaaatgcagaaggcatactttatcagttcctggaaacatcaaagaagctggaaggggaatggaaattggatggcactttgtggaggtcactttgctgacagtcaagtattcaaagatctcctaagatacccggtctttaaagtattatacaaaatatcaggcccagtcccaaggcgcaacttgtgccagcagcccgcgccagcagcctgcaccagcaaaatagcagtagcaagaagagagccagcagaagacacctaccctggccggaagacgcgtacccctgaagattgaggaagaggccatccgggtacaacgtagcagttacgtcagactaagacacttcctgtttataggagactataaaacctttgccctgtcctcactaggggctgacaccattttagtcctcagaccgcctgcacccaggcgctcattaaaacagcatgttgcttccaccgcctcatgttgtctgttggcgcgctctcggggttcgaaccagtacaagaaccttagatatatgatactgcacctaataaaaatagtctaaaataacaacagccaatataggcacaaacctgaaagtgtctgcatagaagtaacacatccatgtacttgataaactaaagtgtagatattttatgcggaataaactttgaagtgaggaatacc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]