GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:20:14, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_134294                271 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens uncharacterized LOC100507464 (LOC100507464), long
            non-coding RNA.
ACCESSION   NR_134294 XR_108905 XR_171722
VERSION     NR_134294.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC090155.10 and AW103845.1.
            On or before Dec 17, 2015 this sequence version replaced
            XR_108905.3, XR_171722.3.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AW103845.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148874
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1                 AC090155.10        78487-78487
            2-271               AW103845.1         1-270               c
FEATURES             Location/Qualifiers
     source          1..271
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q11.21"
     gene            1..271
                     /gene="LOC100507464"
                     /note="uncharacterized LOC100507464"
                     /db_xref="GeneID:100507464"
     ncRNA           1..271
                     /ncRNA_class="lncRNA"
                     /gene="LOC100507464"
                     /product="uncharacterized LOC100507464"
                     /db_xref="GeneID:100507464"
     exon            1..54
                     /gene="LOC100507464"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="LOC100507464"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1401544627"
     variation       7
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394991598"
     variation       16
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750255310"
     variation       18
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563416946"
     variation       19
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301564489"
     variation       21
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545039273"
     variation       22
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017079779"
     variation       24
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053067190"
     variation       25
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1006148082"
     variation       28
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258446026"
     variation       30
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887513964"
     variation       31
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1207781281"
     variation       34
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904617057"
     variation       38
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026092544"
     variation       44
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993159663"
     variation       54
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260485496"
     exon            55..267
                     /gene="LOC100507464"
                     /inference="alignment:Splign:2.1.0"
     variation       57..62
                     /gene="LOC100507464"
                     /replace="gaga"
                     /replace="gagaga"
                     /db_xref="dbSNP:1334209584"
     variation       60
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1004083358"
     variation       68
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221881153"
     variation       71
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906704022"
     variation       73
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255109490"
     variation       77
                     /gene="LOC100507464"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045868277"
     variation       78
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556619235"
     variation       84
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000812402"
     variation       92
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248079182"
     variation       96
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452495933"
     variation       106
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159707224"
     variation       108
                     /gene="LOC100507464"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292477634"
     variation       113
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459406296"
     variation       117
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166556744"
     variation       120
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:894131962"
     variation       128
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038025255"
     variation       138
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440951005"
     variation       140
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296116293"
     variation       144
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941280157"
     variation       145
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908489038"
     variation       148
                     /gene="LOC100507464"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763632931"
     variation       149
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393538905"
     variation       164
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80130201"
     variation       174
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365618467"
     variation       184
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:192482813"
     variation       191
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774858898"
     variation       201
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141340256"
     variation       202
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964154295"
     variation       204
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306026102"
     variation       205
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038083602"
     variation       208
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915240383"
     variation       216
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534193159"
     variation       217
                     /gene="LOC100507464"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75723380"
     variation       218
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474147442"
     variation       222
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956696623"
     variation       223
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1031629740"
     variation       226
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80024861"
     variation       227
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170448713"
     variation       230
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:971274865"
     variation       236
                     /gene="LOC100507464"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463840050"
     variation       264
                     /gene="LOC100507464"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309090139"
ORIGIN      
gagatcaaggaagaggaacacgataaaatgcttatggctccaagaagaaatagggtgagagataggaccacaaattgtttactcatttcaaccagtaaacatgtcctgcaatgtcaatctgtctttctgccacagcagttctgcgcctcctgagttgtttccatctccctccagtcattcaggaccaccaatgagatttgtgatatttggaaaactgccacccagtgcctccttttcctaatctgctgaataaagttaataagactaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]