ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-17 11:02:32, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_132637 594 bp RNA linear ROD 02-APR-2024 DEFINITION Rattus norvegicus homeobox B5 and homeobox B6, opposite strand (Hoxb5os), long non-coding RNA. ACCESSION NR_132637 VERSION NR_132637.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000010.1. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments and orthologous data. ##Evidence-Data-START## Transcript exon combination :: SRR26643299.45155.1, CB734164.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN06680439, SAMN11044071 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-169 JAXUCZ010000010.1 81769118-81769286 c 170-348 JAXUCZ010000010.1 81755760-81755938 c 349-594 JAXUCZ010000010.1 81753421-81753666 c FEATURES Location/Qualifiers source 1..594 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="10" /map="10q26" gene 1..594 /gene="Hoxb5os" /note="homeobox B5 and homeobox B6, opposite strand" /db_xref="GeneID:106455138" /db_xref="RGD:10395317" ncRNA 1..594 /ncRNA_class="lncRNA" /gene="Hoxb5os" /product="homeobox B5 and homeobox B6, opposite strand" /db_xref="GeneID:106455138" /db_xref="RGD:10395317" exon 1..169 /gene="Hoxb5os" /inference="alignment:Splign:2.1.0" exon 170..348 /gene="Hoxb5os" /inference="alignment:Splign:2.1.0" exon 349..594 /gene="Hoxb5os" /inference="alignment:Splign:2.1.0" ORIGIN
atgtcatagcgacttttggggtagtttgctttcggcaaagggggacaaagtcatggggtgagagggaaggagggcccaatgcagcctccaagaccctcaccatctcttcaccggctccccccccccaggtcctgtaagaagttgggcccagctggaagggattgaccggaagcctcctcgccctcggctggcctctgcggagattccaggccccacagagaccaggacgtccctcagcgccaccgcccctcgtgccaatgcagccgggaaatcgccgttacccacactgggcaagagaaccgcacgggggcaatcggggaggccaggacaagggaaaagtggagggagaaggttccaggttggccgtattcaagagcaggctgagcagcgcagaggaagccctggcggcgccggcgctgccaagcttactgcgtccacccaccccagcccggtaaactctccgtcgctcatggggactggttttcctcccattttaaaattttatatggatagcccatgtcaatttagaatgaaatagattttaatacactaagtaaaaacaaattgaaataaaataaaggaatcactccaacg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]