GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 10:30:50, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_130179                510 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens PAGE family member 5 pseudogene (LOC100421746),
            non-coding RNA.
ACCESSION   NR_130179
VERSION     NR_130179.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL158819.14.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AI651025.1, BE551616.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148093
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-65                AL158819.14        101118-101182
            66-157              AL158819.14        102404-102495
            158-266             AL158819.14        102893-103001
            267-392             AL158819.14        103750-103875
            393-510             AL158819.14        109699-109816
FEATURES             Location/Qualifiers
     source          1..510
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp11.21"
     gene            1..510
                     /gene="LOC100421746"
                     /note="PAGE family member 5 pseudogene"
                     /pseudo
                     /db_xref="GeneID:100421746"
     misc_RNA        1..510
                     /gene="LOC100421746"
                     /product="PAGE family member 5 pseudogene"
                     /pseudo
                     /db_xref="GeneID:100421746"
     exon            1..65
                     /gene="LOC100421746"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759092364"
     variation       3
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319032591"
     variation       10
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968429010"
     variation       14
                     /gene="LOC100421746"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978486015"
     variation       15
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1179139501"
     variation       19
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180930448"
     variation       22
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777863363"
     variation       25
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924270664"
     variation       27
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759678698"
     variation       30
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185599162"
     variation       31
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474211380"
     variation       43..49
                     /gene="LOC100421746"
                     /replace="tct"
                     /replace="tctctct"
                     /db_xref="dbSNP:781249821"
     variation       43
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243408334"
     variation       44
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934305433"
     variation       48
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187263600"
     variation       52
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460434093"
     variation       60
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993163244"
     variation       64
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144762628"
     variation       65
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:948553825"
     exon            66..157
                     /gene="LOC100421746"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       73
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891577236"
     variation       75
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112997135"
     variation       78
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330293858"
     variation       82
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447312448"
     variation       92
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195096297"
     variation       95
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302867833"
     variation       96
                     /gene="LOC100421746"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926007577"
     variation       100
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386855515"
     variation       116
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363762291"
     variation       121..122
                     /gene="LOC100421746"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1250950494"
     variation       125
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1140760"
     variation       126..127
                     /gene="LOC100421746"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:758482160"
     exon            158..266
                     /gene="LOC100421746"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       160
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208147060"
     variation       164
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348768791"
     variation       165
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330970548"
     variation       169
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256245371"
     variation       171
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754499740"
     variation       175
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962643236"
     variation       179
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779963055"
     variation       181
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1416406919"
     variation       193
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463371492"
     variation       197
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418985477"
     variation       201
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165273296"
     variation       202
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973013959"
     variation       212
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230755903"
     variation       218
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918425884"
     variation       228
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751722081"
     variation       238
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170300280"
     variation       239
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374174921"
     variation       249
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756003674"
     variation       250
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273564588"
     exon            267..392
                     /gene="LOC100421746"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       271
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1368718899"
     variation       274
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755102804"
     variation       275
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459691223"
     variation       297
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383925693"
     variation       300
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325093569"
     variation       302
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455528849"
     variation       309
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1395086851"
     variation       310
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438584185"
     variation       312
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777526117"
     variation       316
                     /gene="LOC100421746"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452608186"
     variation       321
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753857535"
     variation       322
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757302498"
     variation       323
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1449295120"
     variation       328
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1260074614"
     variation       334
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758330520"
     variation       341
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223926872"
     variation       349
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289846878"
     variation       350
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486647436"
     variation       352
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260891746"
     variation       353
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:186262673"
     variation       354..357
                     /gene="LOC100421746"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1331605605"
     variation       367
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937105783"
     variation       368
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038489542"
     variation       376
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898170329"
     variation       377
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234898952"
     variation       381
                     /gene="LOC100421746"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:994212252"
     variation       383
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745713736"
     variation       386
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293170813"
     exon            393..510
                     /gene="LOC100421746"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       395
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024226385"
     variation       397
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982891816"
     variation       400
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322600445"
     variation       417
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283802794"
     variation       436
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376148027"
     variation       444
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331324961"
     variation       451
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908243988"
     variation       477
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760404265"
     variation       484
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938440330"
     variation       485
                     /gene="LOC100421746"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969549818"
     variation       490
                     /gene="LOC100421746"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295694953"
ORIGIN      
agaagaggtagtatcttcattctttccaccatcttgattctttctctctgactgaggctcagccgtgggaaatatgagtgagcatgtaagaacaagatcccaatcctcagaaagaggaaatgactaagagtcttcccagccagttgtatctgtgattgtccagcagcccactgaggaaaaacgtcaagaagaggagccaccaactgaaaatcagggtattgcacctactggggagatcgaaaatgaagcggcacctgcccttcaaggacctgatgtggaagcttttcaacaggaactggctctgcttaagatagaggatgcacctggagatggtcctgatgtcagggaggggactctgcccactttcgatcccactaaagtgctggaagcaggtaatgggcaaccataggtttaaaccaagacaaatgaagactgaaaccaagaatgttgttcttatgctggaaatttgactgctaacattctcttaataaagttttacagttttctgca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]